LXL04_015395 | RubberDandelionOmics

Gene overview

LXL04_015395

Reference: OH-1004 Chr: Chr03 Coordinates: 70456419-70462970 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

843 bp · LXL04_015395|LXL04_015395|OH1004|cDNA

ATGGATGAGAAGTATAATAAGAAGAATCCATCGGTGAAGAGGATTTTACAGGAGATGAAGGAAATGCAATCGAATCCATCTGATGATTTCACGAGCCTTCCTCTTGAGGAAAACATATTCGAATGGCAGTTTGCAATAAGGGGACCAAATGATACCGAATTTGAAGGAGGAATTTATCACGGTCGAATTCAATTGCCTTCTGAGTACCCATTCAAACCACCATCATTTATGTTGTTAACGCCAAATGGACGTTTTGAAAC...

CDS

Download CDS FASTA

843 bp · LXL04_015395|LXL04_015395|OH1004|CDS

ATGGATGAGAAGTATAATAAGAAGAATCCATCGGTGAAGAGGATTTTACAGGAGATGAAGGAAATGCAATCGAATCCATCTGATGATTTCACGAGCCTTCCTCTTGAGGAAAACATATTCGAATGGCAGTTTGCAATAAGGGGACCAAATGATACCGAATTTGAAGGAGGAATTTATCACGGTCGAATTCAATTGCCTTCTGAGTACCCATTCAAACCACCATCATTTATGTTGTTAACGCCAAATGGACGTTTTGAAAC...

Protein

Download Protein FASTA

280 aa · LXL04_015395|LXL04_015395|OH1004|PROTEIN

MDEKYNKKNPSVKRILQEMKEMQSNPSDDFTSLPLEENIFEWQFAIRGPNDTEFEGGIYHGRIQLPSEYPFKPPSFMLLTPNGRFETQTKICLSISNHHPEHWQPSWSVRTALTALIAFMPTSPNGALGSLDYKKEERRILAIKSREYAPKYGTPDRQRLIDEIHEYMISQAPPPPPPPPPPPPPAATQVTGEAPATTATEITEHGEEPREENHELVAGVVPSASLVVEPRRQEVVQVEKAADDRLFTWAAVGLAIAIVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015395`
TK1151 ID	TkA02G338610
OH-1004 ID	LXL04_015395
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015395

Location Chr03:70456419-70462970 (-)

Description Similar to UBC32: Ubiquitin-conjugating enzyme E2 32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17000`	Accepts the ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015395 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000209 protein polyubiquitination Biological Process

GO:0006487 protein N-linked glycosylation Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0007286 spermatid development Biological Process

GO:0032680 regulation of tumor necrosis factor production Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:1902457 negative regulation of stomatal opening Biological Process

GO:1904153 negative regulation of retrograde protein transport, ER to cytosol Biological Process

GO:0000836 Hrd1p ubiquitin ligase complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G17000

cgr:2889269

dha:DEHA2A09746g

hsa:51465

mmu:56228

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.589

Rank 1 · LXL04_015395 · OH-1004

Cytoplasm0.200

Rank 2 · LXL04_015395 · OH-1004

Golgi apparatus0.196

Rank 3 · LXL04_015395 · OH-1004

Nucleus0.171

Rank 4 · LXL04_015395 · OH-1004

Cell membrane0.105

Rank 5 · LXL04_015395 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00179.32UQ_con14-125 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015395	`PF00179.32`	UQ_con	14	125	2.2e-20	73.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSP7`	Arabidopsis thaliana	Ubiquitin-conjugating enzyme E2 32	62.662%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card