LXL04_015392 | RubberDandelionOmics

Gene overview

LXL04_015392

Reference: OH-1004 Chr: Chr03 Coordinates: 70432194-70436130 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2796 bp · LXL04_015392|LXL04_015392|OH1004|cDNA

ATGGAGGATGGAGATGATGATTTCGGCGATTTATACGCAGATGTTGAAGTGGAAGCAAGCGCAGCCATGAGTGTTGCTCCACAATTCTCACAACTGAAGTTCGTAAACGATGGAAGTGGTAAGCGGAACAATGCCTTAATTGAGAGTGGTGATAAAGAGGAGAGAGTAAGTGATGGTGACGACGACGACGACGACGACGATTTGAATATAGTATTGAATAGCGATGATGATACTATAAGGCATGGGGATGGTTCAACAAT...

CDS

Download CDS FASTA

2796 bp · LXL04_015392|LXL04_015392|OH1004|CDS

ATGGAGGATGGAGATGATGATTTCGGCGATTTATACGCAGATGTTGAAGTGGAAGCAAGCGCAGCCATGAGTGTTGCTCCACAATTCTCACAACTGAAGTTCGTAAACGATGGAAGTGGTAAGCGGAACAATGCCTTAATTGAGAGTGGTGATAAAGAGGAGAGAGTAAGTGATGGTGACGACGACGACGACGACGACGATTTGAATATAGTATTGAATAGCGATGATGATACTATAAGGCATGGGGATGGTTCAACAAT...

Protein

Download Protein FASTA

931 aa · LXL04_015392|LXL04_015392|OH1004|PROTEIN

MEDGDDDFGDLYADVEVEASAAMSVAPQFSQLKFVNDGSGKRNNALIESGDKEERVSDGDDDDDDDDLNIVLNSDDDTIRHGDGSTIARTNTNLQSGELEDEDDDNIGTEEFAGGKAVGNSHSLYKYSRSQSAAYGSESKGSGCVASAYLSRDDNGYCQRTMGQRFSLPWSRSILDVNIDVFEQKPWKHPGADITNYFNFGLDEDSWKLYCNQLDEFRHKGSILSDSPASDPPELQERKGRAIEVEDSIVERQSSMDMRR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015392`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015392

Location Chr03:70432194-70436130 (+)

Description Similar to FIPS3: FIP1[III]-like protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g66652`	Component of the cleavage and polyadenylation specificity factor (CPSF) complex that plays a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition.	No verified direct reference in this release
`At5g58040`	Essential gene.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015392 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006396 RNA processing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006398 mRNA 3'-end processing by stem-loop binding and cleavage Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0031440 regulation of mRNA 3'-end processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005847 mRNA cleavage and polyadenylation specificity factor complex Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0030234 enzyme regulator activity Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT3G66652

ath:AT5G58040

mmu:66899

pon:100172699

rno:289582

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · LXL04_015392 · OH-1004

Cytoplasm0.102

Rank 2 · LXL04_015392 · OH-1004

Cell membrane0.026

Rank 3 · LXL04_015392 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_015392 · OH-1004

Plastid0.010

Rank 5 · LXL04_015392 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05182.19Fip1176-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015392	`PF05182.19`	Fip1	176	218	2.5e-20	72.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JC20`	Arabidopsis thaliana	FIP1[III]-like protein	29.096%	Swiss-Prot	weak database homology
`F4KDH9`	Arabidopsis thaliana	FIP1[V]-like protein	30.453%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card