LXL04_015318 | RubberDandelionOmics

Gene overview

LXL04_015318

Reference: OH-1004 Chr: Chr03 Coordinates: 68449922-68451582 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

714 bp · LXL04_015318|LXL04_015318|OH1004|cDNA

ATGAAGTCGCATCCAGCTTGGAGTTCATCAAAAACCCCAGTTAAGTTCAGAATTCCAACTGCTGAAAATCTGGTTCCCATTCGACTTGATATTGATATAGATGGTCAGAGGTTCAGGGATACATTTACTTGGAACCCTTCTGATCCAGATTCAGATGTAGTTTTGTTTGCAAAAAGAACAGTGAAAGACCTGAAGCTTCCTCCAGCATTTGCAACCCAGATTGCTCAATCCATTCAATCACAGCTTACTGAATTTCGATC...

CDS

Download CDS FASTA

714 bp · LXL04_015318|LXL04_015318|OH1004|CDS

ATGAAGTCGCATCCAGCTTGGAGTTCATCAAAAACCCCAGTTAAGTTCAGAATTCCAACTGCTGAAAATCTGGTTCCCATTCGACTTGATATTGATATAGATGGTCAGAGGTTCAGGGATACATTTACTTGGAACCCTTCTGATCCAGATTCAGATGTAGTTTTGTTTGCAAAAAGAACAGTGAAAGACCTGAAGCTTCCTCCAGCATTTGCAACCCAGATTGCTCAATCCATTCAATCACAGCTTACTGAATTTCGATC...

Protein

Download Protein FASTA

237 aa · LXL04_015318|LXL04_015318|OH1004|PROTEIN

MKSHPAWSSSKTPVKFRIPTAENLVPIRLDIDIDGQRFRDTFTWNPSDPDSDVVLFAKRTVKDLKLPPAFATQIAQSIQSQLTEFRSFEGQDMYTGEKIVPIKLDLRVNHTLIKDQFLWDMNNFDSDPEEFARIFCEDLGIEDPEVGPAIAFTIREQLCEIAIQSVASARETRINKKGRRGVEHLPISKAGGTALDTMKLFGNKSSVIRKRREWDLYEPIVDLLSSEEVDALEARES

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015318`
TK1151 ID	TkA02G347130
OH-1004 ID	LXL04_015318
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015318

Location Chr03:68449922-68451582 (+)

Description Similar to BSH: Chromatin structure-remodeling complex protein BSH

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17590`	Component of a multiprotein complex equivalent of the yeast SWI/SNF complex, an ATP-dependent chromatin-remodeling complex, which is required for the positive and negative regulation of gene expression of a large number of genes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015318 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0000228 nuclear chromosome Cellular Component

GO:0005634 nucleus Cellular Component

GO:0035060 brahma complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003682 chromatin binding Molecular Function

GO:0003712 transcription coregulator activity Molecular Function

GO:0003713 transcription coactivator activity Molecular Function

KEGG gene cross-reference

ath:AT3G17590

dre:799716

xla:443934

xtr:448543

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.631

Rank 1 · LXL04_015318 · OH-1004

Cytoplasm0.384

Rank 2 · LXL04_015318 · OH-1004

Cell membrane0.050

Rank 3 · LXL04_015318 · OH-1004

Lysosome / Vacuole0.044

Rank 4 · LXL04_015318 · OH-1004

Golgi apparatus0.041

Rank 5 · LXL04_015318 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04855.18SNF521-87 aa

PF04855.18SNF5101-233 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015318	`PF04855.18`	SNF5	21	87	8.8e-36	124.5
LXL04_015318	`PF04855.18`	SNF5	101	233	8.8e-36	124.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P93045`	Arabidopsis thaliana	Chromatin structure-remodeling complex protein BSH	78.319%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card