LXL04_015188 | RubberDandelionOmics

Gene overview

LXL04_015188

Reference: OH-1004 Chr: Chr03 Coordinates: 65503119-65507024 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2391 bp · LXL04_015188|LXL04_015188|OH1004|cDNA

ATGTGCGTTAGGGTTGCCCTCAGTAGCAAGAAATTTGCACCATCTTTCCGGAAGTCATCCGCAACTGAACTCGGAAGATATCATGGTCCAAGAAAAGAGATACTAAAGGAATGGAGACTTGGTATTACAGTCATcgaagaaacaaaagaaaatgGTCAGAGGTATCCATCGAATCCAGGGTCAGTCCAAAATCAAATAATGAATGCACTACACTTGGGAGAAAGAGGAAAGGCTTCCAATTTGCTGTCTCATATTGGCTA...

CDS

Download CDS FASTA

2391 bp · LXL04_015188|LXL04_015188|OH1004|CDS

ATGTGCGTTAGGGTTGCCCTCAGTAGCAAGAAATTTGCACCATCTTTCCGGAAGTCATCCGCAACTGAACTCGGAAGATATCATGGTCCAAGAAAAGAGATACTAAAGGAATGGAGACTTGGTATTACAGTCATCGAAGAAACAAAAGAAAATGGTCAGAGGTATCCATCGAATCCAGGGTCAGTCCAAAATCAAATAATGAATGCACTACACTTGGGAGAAAGAGGAAAGGCTTCCAATTTGCTGTCTCATATTGGCTA...

Protein

Download Protein FASTA

796 aa · LXL04_015188|LXL04_015188|OH1004|PROTEIN

MCVRVALSSKKFAPSFRKSSATELGRYHGPRKEILKEWRLGITVIEETKENGQRYPSNPGSVQNQIMNALHLGERGKASNLLSHIGYKNHMLKPNNFVKILEYCAHTPDPPFVLEIWRTMEEKGVDLDNKSHVFVIQALCKGGYIEQAFNLMNNCGESQHLFPSVDKYNIILEALAKLKDVTYVGKCLDKMEHDMVGKNETTYTELLKLAVLQKNLSAVHSIWKEYAKYYNFNLISLREFIWAFTRLGDVESSYEALQQL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015188`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015188

Location Chr03:65503119-65507024 (+)

Description Similar to At1g76280: Pentatricopeptide repeat-containing protein At1g76280

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76280`	Pentatricopeptide repeat-containing protein At1g76280.	No verified direct reference in this release
`At1g63130`	Pentatricopeptide repeat-containing protein At1g63130, mitochondrial.	No verified direct reference in this release
`At1g63400`	Pentatricopeptide repeat-containing protein At1g63400.	No verified direct reference in this release
`At1g62910`	Pentatricopeptide repeat-containing protein At1g62910.	No verified direct reference in this release
`At1g62930`	Pentatricopeptide repeat-containing protein At1g62930, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015188 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G63130

ath:AT1G63400

ath:AT1G76280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.601

Rank 1 · LXL04_015188 · OH-1004

Plastid0.289

Rank 2 · LXL04_015188 · OH-1004

Nucleus0.061

Rank 3 · LXL04_015188 · OH-1004

Cytoplasm0.038

Rank 4 · LXL04_015188 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_015188 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23276.3TPR_2498-194 aa

PF23276.3TPR_24332-454 aa

PF13812.13PPR_3430-476 aa

PF13041.13PPR_2432-472 aa

PF29070.1MSC6_N497-643 aa

PF13041.13PPR_2550-593 aa

PF17177.11PPR_long550-682 aa

PF29070.1MSC6_N564-710 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015188	`PF23276.3`	TPR_24	98	194	5.9e-22	78.7
LXL04_015188	`PF23276.3`	TPR_24	332	454	5.9e-22	78.7
LXL04_015188	`PF13812.13`	PPR_3	430	476	3.7e-32	110.9
LXL04_015188	`PF13041.13`	PPR_2	432	472	3.8e-45	152.5
LXL04_015188	`PF29070.1`	MSC6_N	497	643	7.7e-19	68.8
LXL04_015188	`PF13041.13`	PPR_2	550	593	3.8e-45	152.5
LXL04_015188	`PF17177.11`	PPR_long	550	682	3.6e-21	76.2
LXL04_015188	`PF29070.1`	MSC6_N	564	710	7.7e-19	68.8
LXL04_015188	`PF13812.13`	PPR_3	640	687	3.7e-32	110.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGQ6`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g76280	42.972%	Swiss-Prot	moderate database homology
`Q9CAN0`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g63130, mitochondrial	21.886%	Swiss-Prot	weak database homology
`Q9SH26`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g63400	20.641%	Swiss-Prot	weak database homology
`Q9LQ16`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g62910	20.107%	Swiss-Prot	weak database homology
`Q9LQ14`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g62930, chloroplastic	19.751%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card