LXL04_015043 | RubberDandelionOmics

Gene overview

LXL04_015043

Reference: OH-1004 Chr: Chr03 Coordinates: 62423138-62426565 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1479 bp · LXL04_015043|LXL04_015043|OH1004|cDNA

ATGGCTACTGTCGTTAATGGAGAAGAACGCGAGATTCAGAAGAATTACTGGGTGGAACACTCTGTCGACCTTACAGTTGAGGCTATGATGCTTGATTCTATGGCATCTGATCTTGACAAAGAAGAACGCCCTGAGGTACTGTCACTACTCCCACCTTATGAAGGAAAAACCGTTCTTGAACTAGGAGCTGGAATTGGTCGTTTTACTGGTGAACTAGTCAAAAAGGCTGGAAAGGTCATAGCCCTTGATTTCATTGAAAG...

CDS

Download CDS FASTA

1479 bp · LXL04_015043|LXL04_015043|OH1004|CDS

ATGGCTACTGTCGTTAATGGAGAAGAACGCGAGATTCAGAAGAATTACTGGGTGGAACACTCTGTCGACCTTACAGTTGAGGCTATGATGCTTGATTCTATGGCATCTGATCTTGACAAAGAAGAACGCCCTGAGGTACTGTCACTACTCCCACCTTATGAAGGAAAAACCGTTCTTGAACTAGGAGCTGGAATTGGTCGTTTTACTGGTGAACTAGTCAAAAAGGCTGGAAAGGTCATAGCCCTTGATTTCATTGAAAG...

Protein

Download Protein FASTA

492 aa · LXL04_015043|LXL04_015043|OH1004|PROTEIN

MATVVNGEEREIQKNYWVEHSVDLTVEAMMLDSMASDLDKEERPEVLSLLPPYEGKTVLELGAGIGRFTGELVKKAGKVIALDFIESVVKKNESNNGHHKNVEFMCADVTSPDLKFEAESIDLIFSNWLLMYLSDKEVENIAERLLKWVKVGGHIFFRESCFHQSGDHKRKSNPTHYREPRFYTKVFKECHVSNESGNSYELSLVGSKCIGAYVRNKKNQNQICWIWQKVNAEDDKGFQKFLDNVQYKSSGILRYERIFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015043`
TK1151 ID	TkA02G372710
OH-1004 ID	LXL04_015043
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015043

Location Chr03:62423138-62426565 (-)

Description Similar to NMT1: Phosphoethanolamine N-methyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18000`	Involved in phosphocholine biosynthesis.	The xipotl mutant of Arabidopsis reveals a critical role for phospholipid metabolism in root system development and epidermal cell integrity.2004 · DOI: 10.1105/tpc.103.018648 NMT1 and NMT3 N -Methyltransferase Activity Is Critical to Lipid Homeostasis, Morphogenesis, and Reproduction.2018 · DOI: 10.1104/pp.18.00457 Phosphoethanolamine N-methyltransferase 1 contributes to maintenance of root apical meristem by affecting ROS and auxin-regulated cell differentiation in Arabidopsis.2019 · DOI: 10.1111/nph.16028
`At1g73600`	Involved in phosphocholine biosynthesis.	NMT1 and NMT3 N -Methyltransferase Activity Is Critical to Lipid Homeostasis, Morphogenesis, and Reproduction.2018 · DOI: 10.1104/pp.18.00457
`At1g48600`	Catalyzes N-methylation of phosphomonomethylethanolamine and phosphodimethylethanolamine, the two methylation steps required to convert phosphomonoethanolamine to phosphocholine.	Identification of phosphomethylethanolamine N-methyltransferase from Arabidopsis and its role in choline and phospholipid metabolism.2010 · DOI: 10.1074/jbc.m110.112151

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015043 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006651 diacylglycerol biosynthetic process Biological Process

GO:0006656 phosphatidylcholine biosynthetic process Biological Process

GO:0009555 pollen development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0032259 methylation Biological Process

GO:0042425 choline biosynthetic process Biological Process

GO:0046337 phosphatidylethanolamine metabolic process Biological Process

GO:0048528 post-embryonic root development Biological Process

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G48600

ath:AT1G73600

ath:AT3G18000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.727

Rank 1 · LXL04_015043 · OH-1004

Nucleus0.396

Rank 2 · LXL04_015043 · OH-1004

Mitochondrion0.070

Rank 3 · LXL04_015043 · OH-1004

Peroxisome0.053

Rank 4 · LXL04_015043 · OH-1004

Cell membrane0.053

Rank 5 · LXL04_015043 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01209.25Ubie_methyltran32-157 aa

PF13489.13Methyltransf_2343-164 aa

PF13847.13Methyltransf_3154-178 aa

PF01728.26FtsJ54-126 aa

PF05891.19Methyltransf_PK56-192 aa

PF13649.13Methyltransf_2558-153 aa

PF08241.19Methyltransf_1159-157 aa

PF08242.19Methyltransf_1259-155 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015043	`PF01209.25`	Ubie_methyltran	32	157	6.3e-20	72.2
LXL04_015043	`PF13489.13`	Methyltransf_23	43	164	1.2e-29	103.9
LXL04_015043	`PF13847.13`	Methyltransf_31	54	178	1.2e-36	126.4
LXL04_015043	`PF01728.26`	FtsJ	54	126	2.2e-08	35.0
LXL04_015043	`PF05891.19`	Methyltransf_PK	56	192	4.6e-12	46.7
LXL04_015043	`PF13649.13`	Methyltransf_25	58	153	9.4e-37	126.3
LXL04_015043	`PF08241.19`	Methyltransf_11	59	157	1e-36	126.1
LXL04_015043	`PF08242.19`	Methyltransf_12	59	155	8.9e-25	88.0
LXL04_015043	`PF05175.21`	MTS	262	355	5.4e-09	36.6
LXL04_015043	`PF01135.26`	PCMT	274	384	3e-09	37.7
LXL04_015043	`PF02353.27`	CMAS	275	461	5.6e-15	56.1
LXL04_015043	`PF01209.25`	Ubie_methyltran	279	390	6.3e-20	72.2
LXL04_015043	`PF13489.13`	Methyltransf_23	280	424	1.2e-29	103.9
LXL04_015043	`PF07021.19`	MetW	281	363	1.5e-06	28.7
LXL04_015043	`PF13847.13`	Methyltransf_31	282	391	1.2e-36	126.4
LXL04_015043	`PF13649.13`	Methyltransf_25	287	380	9.4e-37	126.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FR44`	Arabidopsis thaliana	Phosphoethanolamine N-methyltransferase 1	82.438%	Swiss-Prot	strong database homology
`Q9C6B9`	Arabidopsis thaliana	Phosphoethanolamine N-methyltransferase 3	81.443%	Swiss-Prot	strong database homology
`Q944H0`	Arabidopsis thaliana	Phosphoethanolamine N-methyltransferase 2	82.724%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card