LXL04_014990 | RubberDandelionOmics

Gene overview

LXL04_014990

Reference: OH-1004 Chr: Chr03 Coordinates: 60864524-60866335 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1812 bp · LXL04_014990|LXL04_014990|OH1004|cDNA

ATGCATATTTCTTTCAGAAGATTCAGTTCCATTCCAACTCCACAACCAGATACGATACTTATCAGAAAGGTCAAAGATTTGATCTTGCAAGGACTACATGTTGAAGCTCTTCATCTCTACAAAAACCAACTGCATCTCCATGCGAACACTTGTACCTCTATTATTCCTTCGATCATAAAAGCTTGTACGCTCTCTCAAACCCACCATGGCTTCGGTCTTCAGCTTCATTCTCACTCCCTCAAACTGGGGGTTGATTCAGA...

CDS

Download CDS FASTA

1812 bp · LXL04_014990|LXL04_014990|OH1004|CDS

ATGCATATTTCTTTCAGAAGATTCAGTTCCATTCCAACTCCACAACCAGATACGATACTTATCAGAAAGGTCAAAGATTTGATCTTGCAAGGACTACATGTTGAAGCTCTTCATCTCTACAAAAACCAACTGCATCTCCATGCGAACACTTGTACCTCTATTATTCCTTCGATCATAAAAGCTTGTACGCTCTCTCAAACCCACCATGGCTTCGGTCTTCAGCTTCATTCTCACTCCCTCAAACTGGGGGTTGATTCAGA...

Protein

Download Protein FASTA

603 aa · LXL04_014990|LXL04_014990|OH1004|PROTEIN

MHISFRRFSSIPTPQPDTILIRKVKDLILQGLHVEALHLYKNQLHLHANTCTSIIPSIIKACTLSQTHHGFGLQLHSHSLKLGVDSESVISNSFISFYAKFHDITSARQVFDKMPHRDCISWNSIINCFAQKGSYLESLEKFKEMYECGYVAKPELIASILSVCVRHGCTKAGKTIHALSIIDNRFEKSVFLSTALVDLYCRSGDSIMASHVFDSMDYKNEVSWTSMIQGYVGINDSNMALNCLQKMQIEGIKPNIVTLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014990`
TK1151 ID	TkA02G379080
OH-1004 ID	LXL04_014990
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014990

Location Chr03:60864524-60866335 (+)

Description Similar to PCMP-E7: Pentatricopeptide repeat-containing protein At4g31070, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31070`	Pentatricopeptide repeat-containing protein At4g31070, mitochondrial.	No verified direct reference in this release
`At5g27110`	Pentatricopeptide repeat-containing protein At5g27110.	No verified direct reference in this release
`At4g18750`	Plays a major role in single RNA editing events in chloroplasts.	Identification of two pentatricopeptide repeat genes required for RNA editing and zinc binding by C-terminal cytidine deaminase-like domains.2013 · DOI: 10.1074/jbc.m113.485755
`At4g33990`	Pentatricopeptide repeat-containing protein At4g33990.	No verified direct reference in this release
`At4g35130`	Pentatricopeptide repeat-containing protein At4g35130, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014990 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0010588 cotyledon vascular tissue pattern formation Biological Process

GO:0048366 leaf development Biological Process

GO:0099402 plant organ development Biological Process

GO:1900865 chloroplast RNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G18750

ath:AT4G31070

ath:AT5G27110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.654

Rank 1 · LXL04_014990 · OH-1004

Plastid0.158

Rank 2 · LXL04_014990 · OH-1004

Nucleus0.046

Rank 3 · LXL04_014990 · OH-1004

Cytoplasm0.033

Rank 4 · LXL04_014990 · OH-1004

Cell membrane0.005

Rank 5 · LXL04_014990 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01535.27PPR120-149 aa

PF13041.13PPR_2220-266 aa

PF13812.13PPR_3222-266 aa

PF13041.13PPR_2321-369 aa

PF23276.3TPR_24422-518 aa

PF13041.13PPR_2423-470 aa

PF13812.13PPR_3423-470 aa

PF01535.27PPR426-456 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014990	`PF01535.27`	PPR	120	149	1.4e-44	148.0
LXL04_014990	`PF13041.13`	PPR_2	220	266	1.4e-45	153.9
LXL04_014990	`PF13812.13`	PPR_3	222	266	3.2e-23	82.3
LXL04_014990	`PF13041.13`	PPR_2	321	369	1.4e-45	153.9
LXL04_014990	`PF23276.3`	TPR_24	422	518	1.4e-19	71.0
LXL04_014990	`PF13041.13`	PPR_2	423	470	1.4e-45	153.9
LXL04_014990	`PF13812.13`	PPR_3	423	470	3.2e-23	82.3
LXL04_014990	`PF01535.27`	PPR	426	456	1.4e-44	148.0
LXL04_014990	`PF20431.5`	E_motif	550	601	1.4e-13	51.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65543`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g31070, mitochondrial	45.826%	Swiss-Prot	moderate database homology
`O04659`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g27110	35.572%	Swiss-Prot	moderate database homology
`Q9SN39`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein DOT4, chloroplastic	32.337%	Swiss-Prot	moderate database homology
`O81767`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g33990	33.031%	Swiss-Prot	moderate database homology
`O49619`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g35130, chloroplastic	32.991%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card