LXL04_014291 | RubberDandelionOmics

Gene overview

LXL04_014291

Reference: OH-1004 Chr: Chr03 Coordinates: 45550790-45551686 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

897 bp · LXL04_014291|LXL04_014291|OH1004|cDNA

ATGGAGAACAACAATAATCAAAGAAAATGGAGAAAAGTTGCGTACGGAGGCATGCAACCAGGATTCAACGACAATCACACAGACGAAACCTTCCTTCAAGAAATGGTAATGAACGCCAACGTCGTCAAAAGAGACATCCTCAAAGTAATGCTAGACTCCCTCTCAATCTCCCAATACCTTTCCATCGTATCACTCGTAGTTCTAATCTGGACCCACACTCTCAATTCCACCATCACTCACACCTCTCTACTAATCCTCGA...

CDS

Download CDS FASTA

897 bp · LXL04_014291|LXL04_014291|OH1004|CDS

ATGGAGAACAACAATAATCAAAGAAAATGGAGAAAAGTTGCGTACGGAGGCATGCAACCAGGATTCAACGACAATCACACAGACGAAACCTTCCTTCAAGAAATGGTAATGAACGCCAACGTCGTCAAAAGAGACATCCTCAAAGTAATGCTAGACTCCCTCTCAATCTCCCAATACCTTTCCATCGTATCACTCGTAGTTCTAATCTGGACCCACACTCTCAATTCCACCATCACTCACACCTCTCTACTAATCCTCGA...

Protein

Download Protein FASTA

298 aa · LXL04_014291|LXL04_014291|OH1004|PROTEIN

MENNNNQRKWRKVAYGGMQPGFNDNHTDETFLQEMVMNANVVKRDILKVMLDSLSISQYLSIVSLVVLIWTHTLNSTITHTSLLILDITLLASGFFILLLTAKMLSFSLLINYSIKISFFTTSLYVLSPIYHTLTRSISSDSIWALTTSLIIIHLFLHDYSGSTIKAPGALETNPTLASNISLNASIVASLLIASRLPSRVLVFAVILFSLQVFLFAPLVTYCVKKYSLRLHVGLSVVVMGVSLGCVYELHRVMFVVLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014291`
TK1151 ID	TkA02G441260
OH-1004 ID	LXL04_014291
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014291

Location Chr03:45550790-45551686 (-)

Description Similar to PIGC: Phosphatidylinositol N-acetylglucosaminyltransferase subunit C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g34980`	Part of the complex catalyzing the transfer of N-acetylglucosamine from UDP-N-acetylglucosamine to phosphatidylinositol, the first step of GPI biosynthesis (Probable).	SETH1 and SETH2, two components of the glycosylphosphatidylinositol anchor biosynthetic pathway, are required for pollen germination and tube growth in Arabidopsis.2004 · DOI: 10.1105/tpc.014407

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014291 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006506 GPI anchor biosynthetic process Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0000506 glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0003824 catalytic activity Molecular Function

GO:0017176 phosphatidylinositol N-acetylglucosaminyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G34980

ddi:DDB_G0286221

hsa:5279

mmu:67292

rno:364032

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.552

Rank 1 · LXL04_014291 · OH-1004

Golgi apparatus0.200

Rank 2 · LXL04_014291 · OH-1004

Lysosome / Vacuole0.144

Rank 3 · LXL04_014291 · OH-1004

Cytoplasm0.117

Rank 4 · LXL04_014291 · OH-1004

Nucleus0.103

Rank 5 · LXL04_014291 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06432.17GPI210-288 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014291	`PF06432.17`	GPI2	10	288	9.2e-77	259.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64761`	Arabidopsis thaliana	Phosphatidylinositol N-acetylglucosaminyltransferase subunit C	71.821%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card