LXL04_014238 | RubberDandelionOmics

Gene overview

LXL04_014238

Reference: OH-1004 Chr: Chr03 Coordinates: 44237374-44238673 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

561 bp · LXL04_014238|LXL04_014238|OH1004|cDNA

ATGGCTGCCTTTACCTCTTCTGTACTACGGAGTGCCGTAACCATCGGAGCTTTAGCCCCTTTCAATCCAGTGAAGCAACAGCATTCCTTTCGTCTAATTCAGTCAAACTTCCGACTTCCTGTCCACCAATGTACTCGCAGtCCCATATCTCGTGTGAGTGCCACACATGATGAAGAGGCTTCTGCTAAATCAGCTGCAACTGAAGCCAACACTGGAGCTCCAACCATATTTGACAAAATTATCTCAAAGGAGATCCCATC...

CDS

Download CDS FASTA

561 bp · LXL04_014238|LXL04_014238|OH1004|CDS

ATGGCTGCCTTTACCTCTTCTGTACTACGGAGTGCCGTAACCATCGGAGCTTTAGCCCCTTTCAATCCAGTGAAGCAACAGCATTCCTTTCGTCTAATTCAGTCAAACTTCCGACTTCCTGTCCACCAATGTACTCGCAGTCCCATATCTCGTGTGAGTGCCACACATGATGAAGAGGCTTCTGCTAAATCAGCTGCAACTGAAGCCAACACTGGAGCTCCAACCATATTTGACAAAATTATCTCAAAGGAGATCCCATC...

Protein

Download Protein FASTA

186 aa · LXL04_014238|LXL04_014238|OH1004|PROTEIN

MAAFTSSVLRSAVTIGALAPFNPVKQQHSFRLIQSNFRLPVHQCTRSPISRVSATHDEEASAKSAATEANTGAPTIFDKIISKEIPSDIIYEDERVLAFRDINPQAPVHVLLIPKLRDGLTELGKAEARHEDILGHLMHVSKIVAEKEGIVDGFRVVINSGPTACQSVYHLHLHVLGGRQLKWPPG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014238`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014238

Location Chr03:44237374-44238673 (+)

Description Similar to ZBP14: 14 kDa zinc-binding protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56490`	Possesses adenylylsulfatase activity in vitro.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014238 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006694 steroid biosynthetic process Biological Process

GO:0006790 sulfur compound metabolic process Biological Process

GO:0009150 purine ribonucleotide metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT3G56490

hsa:84681

syf:Synpcc7942_1390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.962

Rank 1 · LXL04_014238 · OH-1004

Mitochondrion0.057

Rank 2 · LXL04_014238 · OH-1004

Nucleus0.017

Rank 3 · LXL04_014238 · OH-1004

Cytoplasm0.016

Rank 4 · LXL04_014238 · OH-1004

Cell membrane0.009

Rank 5 · LXL04_014238 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11969.14DcpS_C75-177 aa

PF01230.30HIT83-180 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014238	`PF11969.14`	DcpS_C	75	177	5.8e-23	82.3
LXL04_014238	`PF01230.30`	HIT	83	180	1.1e-27	97.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUN2`	Arabidopsis thaliana	Adenylylsulfatase HINT1	62.857%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card