LXL04_014202 | RubberDandelionOmics

Gene overview

LXL04_014202

Reference: OH-1004 Chr: Chr03 Coordinates: 43598616-43604462 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3519 bp · LXL04_014202|LXL04_014202|OH1004|cDNA

ATGGAGAGCAGCGGTACAGCGAGCGATGTTGCCCGAGCTATCGTCGCCGCCCTTGGCTGGAACTCTTCCTCGGATGATCGGAAATCTGCGATGTCCTACTTAGAATCTGTAAAAGCTGGGGATGTTCGTGTTTTGGCCAGCACATCATTTCTGTTAGTAAAGAAAGATTGGCCTTCTGAAGTTCGTTTGCATGCATTTAAATTGTTGCAGCATCTGGTGCGACTACGTTGGGATGAATTAAGCCCTGAAGAAAGACGAGA...

CDS

Download CDS FASTA

3519 bp · LXL04_014202|LXL04_014202|OH1004|CDS

ATGGAGAGCAGCGGTACAGCGAGCGATGTTGCCCGAGCTATCGTCGCCGCCCTTGGCTGGAACTCTTCCTCGGATGATCGGAAATCTGCGATGTCCTACTTAGAATCTGTAAAAGCTGGGGATGTTCGTGTTTTGGCCAGCACATCATTTCTGTTAGTAAAGAAAGATTGGCCTTCTGAAGTTCGTTTGCATGCATTTAAATTGTTGCAGCATCTGGTGCGACTACGTTGGGATGAATTAAGCCCTGAAGAAAGACGAGA...

Protein

Download Protein FASTA

1172 aa · LXL04_014202|LXL04_014202|OH1004|PROTEIN

MESSGTASDVARAIVAALGWNSSSDDRKSAMSYLESVKAGDVRVLASTSFLLVKKDWPSEVRLHAFKLLQHLVRLRWDELSPEERREFAKVSMDLMNEIANSFEEWALKSQTAALIAEIVRREGVSLWQELVPSLVALSNSGPTHAEMVCMMLRWLPEDITVHNEDLEGDRRRLLLRGITESLPEILPLLYTLLERHFGAAMTEAGRQQLDVAKQHAATVTATLNAINAYAEWAPVPYLSKYGTIHGCGFLLSSPDFRLH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014202`
TK1151 ID	TkA02G447750
OH-1004 ID	LXL04_014202
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014202

Location Chr03:43598616-43604462 (+)

Description Similar to HST1: Protein HASTY 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g05040`	Nucleocytoplasmic transporter involved in the nuclear export of microRNAs (miRNAs).	HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase change and morphogenesis.2003 · DOI: 10.1242/dev.00362 Nuclear processing and export of microRNAs in Arabidopsis.2005 · DOI: 10.1073/pnas.0405570102 Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3.2006 · DOI: 10.1242/dev.02521

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014202 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006405 RNA export from nucleus Biological Process

GO:0006611 protein export from nucleus Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0009965 leaf morphogenesis Biological Process

GO:0010586 miRNA metabolic process Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0035281 pre-miRNA export from nucleus Biological Process

GO:0048364 root development Biological Process

GO:0048367 shoot system development Biological Process

GO:0061716 miRNA export from nucleus Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G05040

ddi:DDB_G0284379

hsa:57510

mmu:72322

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.681

Rank 1 · LXL04_014202 · OH-1004

Cytoplasm0.363

Rank 2 · LXL04_014202 · OH-1004

Golgi apparatus0.055

Rank 3 · LXL04_014202 · OH-1004

Lysosome / Vacuole0.050

Rank 4 · LXL04_014202 · OH-1004

Cell membrane0.048

Rank 5 · LXL04_014202 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08389.19Xpo1106-264 aa

PF19273.6Exportin-5313-1137 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014202	`PF08389.19`	Xpo1	106	264	5.7e-28	98.6
LXL04_014202	`PF19273.6`	Exportin-5	313	1137	3.6e-274	912.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WP44`	Arabidopsis thaliana	Protein HASTY 1	60.976%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card