LXL04_014156 | RubberDandelionOmics

Gene overview

LXL04_014156

Reference: OH-1004 Chr: Chr03 Coordinates: 42965625-42967027 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

678 bp · LXL04_014156|LXL04_014156|OH1004|cDNA

ATGGGTCAACCACAGCCGCCTGTGAGAACTACTCCTCAGAAAGCAGATTCATTTCCCAGCTTTAAAATTTCAATGGCATTGGCTGCTCGGACAATTGTTTGCAATCTGAATTCGGAAAACCCGGCGATTCAAAGAGATGGACCGGGGGCTGGGAAGCTCCCCTCGCTCCCGGTTCAGAAGGTGAGGCTGACAGATTCGGCCGCCGTGAAGGCTGAGAGTGGGAAGATCGTATTGCAGCCAAGGGTGTGCACGCTTAGATC...

CDS

Download CDS FASTA

678 bp · LXL04_014156|LXL04_014156|OH1004|CDS

ATGGGTCAACCACAGCCGCCTGTGAGAACTACTCCTCAGAAAGCAGATTCATTTCCCAGCTTTAAAATTTCAATGGCATTGGCTGCTCGGACAATTGTTTGCAATCTGAATTCGGAAAACCCGGCGATTCAAAGAGATGGACCGGGGGCTGGGAAGCTCCCCTCGCTCCCGGTTCAGAAGGTGAGGCTGACAGATTCGGCCGCCGTGAAGGCTGAGAGTGGGAAGATCGTATTGCAGCCAAGGGTGTGCACGCTTAGATC...

Protein

Download Protein FASTA

225 aa · LXL04_014156|LXL04_014156|OH1004|PROTEIN

MGQPQPPVRTTPQKADSFPSFKISMALAARTIVCNLNSENPAIQRDGPGAGKLPSLPVQKVRLTDSAAVKAESGKIVLQPRVCTLRSYGSDRSGVMKMRTVEDDGDEVSRFFEMLSEYIESSKNSQDFEIISGRLAMMVFAGTVTMEVVTGNSLFRKMDLQGIEEAVGVCLGVVACAATFAWFSGARNSVGGMFSVRCNTFIDSLIDQVVDGLFYETDISDWPDL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014156`
TK1151 ID	TkA02G449810
OH-1004 ID	LXL04_014156
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 89.333 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014156

Location Chr03:42965625-42967027 (-)

Description Similar to SEP2: Stress enhanced protein 2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g21970`	May be involved in non-photochemical quenching, a process that maintains the balance between dissipation and utilization of light energy to minimize generation of oxidizing molecules, thereby protecting the plant against photo-oxidative damage (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014156 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009765 photosynthesis, light harvesting Biological Process

GO:0071486 cellular response to high light intensity Biological Process

GO:0071492 cellular response to UV-A Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009523 photosystem II Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0016168 chlorophyll binding Molecular Function

KEGG gene cross-reference

ath:AT2G21970

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.981

Rank 1 · LXL04_014156 · OH-1004

Mitochondrion0.025

Rank 2 · LXL04_014156 · OH-1004

Nucleus0.017

Rank 3 · LXL04_014156 · OH-1004

Cytoplasm0.013

Rank 4 · LXL04_014156 · OH-1004

Cell membrane0.009

Rank 5 · LXL04_014156 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJ02`	Arabidopsis thaliana	Stress enhanced protein 2, chloroplastic	51.456%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card