LXL04_014131 | RubberDandelionOmics

Gene overview

LXL04_014131

Reference: OH-1004 Chr: Chr03 Coordinates: 42454762-42459166 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2023 bp · LXL04_014131|LXL04_014131|OH1004|cDNA

ATGGACTTCGACGAGTATGACTACTTGGAGAAGACCGTCGACGAGCCTGACAGCCGGAACGGTTCTTCTTCGAAGGACAAGGACGGCGGCGCCGACAAGAGAGATAAGGGTTACAGACGGAGGGAAAGAGATGATGACAACGAGGAAGATGACCGAATCGTAGAAGAAAACCGAAAGAGTAAGAAAAGCAAAGGAGATGAAGAGAACGGTGGGAGTAGGAGAGATAGAGACCGTGACCGTGACCGTGAGGAGAGGTCTTC...

CDS

Download CDS FASTA

2001 bp · LXL04_014131|LXL04_014131|OH1004|CDS

ATGGACTTCGACGAGTATGACTACTTGGAGAAGACCGTCGACGAGCCTGACAGCCGGAACGGTTCTTCTTCGAAGGACAAGGACGGCGGCGCCGACAAGAGAGATAAGGGTTACAGACGGAGGGAAAGAGATGATGACAACGAGGAAGATGACCGAATCGTAGAAGAAAACCGAAAGAGTAAGAAAAGCAAAGGAGATGAAGAGAACGGTGGGAGTAGGAGAGATAGAGACCGTGACCGTGACCGTGAGGAGAGGTCTTC...

Protein

Download Protein FASTA

666 aa · LXL04_014131|LXL04_014131|OH1004|PROTEIN

MDFDEYDYLEKTVDEPDSRNGSSSKDKDGGADKRDKGYRRRERDDDNEEDDRIVEENRKSKKSKGDEENGGSRRDRDRDRDREERSSRSERHRSSGRDPEREVDRERDRDRRRSSRDRERSSRDMEKDKDRERERSSRDKDKDREKEKKDRERDREKEREREKREREREKERERSRRSRSHSRLEREREKELLREKERELESKESRLAAWSWNIGFDYYYTIALAIYLPASMIRVLVVSHKTRVLAFVYGVFAHTNELTM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014131`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_014131`
Location	Chr03:42454762-42459166 (+)
Description	Similar to RBM39: RNA-binding protein 39
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014131` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0006396 RNA processing Biological Process GO:0006397 mRNA processing Biological Process GO:0008380 RNA splicing Biological Process GO:0045292 mRNA cis splicing, via spliceosome Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0015630 microtubule cytoskeleton Cellular Component
KEGG gene cross-reference	hsa:55147 hsa:9584 mmu:170791 pon:100172241 spo:2542545 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · LXL04_014131 · OH-1004

Cytoplasm0.115

Rank 2 · LXL04_014131 · OH-1004

Cell membrane0.027

Rank 3 · LXL04_014131 · OH-1004

Endoplasmic reticulum0.011

Rank 4 · LXL04_014131 · OH-1004

Mitochondrion0.007

Rank 5 · LXL04_014131 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_1307-369 aa

PF00076.29RRM_1405-475 aa

PF15519.12RBM39linker495-590 aa

PF29326.1RRM_MUD2_C571-660 aa

PF00076.29RRM_1596-646 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014131	`PF00076.29`	RRM_1	307	369	9.7e-43	144.6
LXL04_014131	`PF00076.29`	RRM_1	405	475	9.7e-43	144.6
LXL04_014131	`PF15519.12`	RBM39linker	495	590	2.3e-20	73.8
LXL04_014131	`PF29326.1`	RRM_MUD2_C	571	660	2.8e-07	31.3
LXL04_014131	`PF00076.29`	RRM_1	596	646	9.7e-43	144.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card