LXL04_014094 | RubberDandelionOmics

Gene overview

LXL04_014094

Reference: OH-1004 Chr: Chr03 Coordinates: 42013510-42016072 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2251 bp · LXL04_014094|LXL04_014094|OH1004|cDNA

ATGTTACGTTCCAAATCCAGATCTGGTTATTTGGAATTTGGGCAAAAGAAGCAGCAATCGTTTCTCGTTAGAAGCATTTCCGGATCGAAGTTTTGCAGGGGAGATGCTCTTGCTTCACAAGTCGCTAAAGAAGCCGTTGTTCCCGTTGATCGCAAGTCCATTAGTTTATCAGAGAATCGGATTGTTAAGGCTGCCATGATGCAAAGGCAAGTAACCGATTTACAGGAGGAGTTGAAGAACACAAAGGCGAGATTAGATGA...

CDS

Download CDS FASTA

2145 bp · LXL04_014094|LXL04_014094|OH1004|CDS

ATGTTACGTTCCAAATCCAGATCTGGTTATTTGGAATTTGGGCAAAAGAAGCAGCAATCGTTTCTCGTTAGAAGCATTTCCGGATCGAAGTTTTGCAGGGGAGATGCTCTTGCTTCACAAGTCGCTAAAGAAGCCGTTGTTCCCGTTGATCGCAAGTCCATTAGTTTATCAGAGAATCGGATTGTTAAGGCTGCCATGATGCAAAGGCAAGTAACCGATTTACAGGAGGAGTTGAAGAACACAAAGGCGAGATTAGATGA...

Protein

Download Protein FASTA

714 aa · LXL04_014094|LXL04_014094|OH1004|PROTEIN

MLRSKSRSGYLEFGQKKQQSFLVRSISGSKFCRGDALASQVAKEAVVPVDRKSISLSENRIVKAAMMQRQVTDLQEELKNTKARLDEAERERNRLYTELKGGLSSKKAEQVFSELNILKDSLLNSKKEIESRDRDMKILTSRLESAKVFEAKLSERDKKIRELEDQVAKAQQSESNMLESLMLQTQQLTEIKMDLEESKLEITSLYERLDNGGNNNTSRGNYNHNQNQNQNQNQYQASAETKALKDEIAMLKNEIKRATE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014094`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014094

Location Chr03:42013510-42016072 (-)

Description Similar to At1g65010: Putative WEB family protein At1g65010, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65010`	Putative WEB family protein At1g65010, chloroplastic.	No verified direct reference in this release
`At3g02930`	WEB family protein At3g02930, chloroplastic.	No verified direct reference in this release
`At5g16730`	WEB family protein At5g16730, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014094 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005875 microtubule associated complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G65010

ath:AT3G02930

ath:AT5G16730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.489

Rank 1 · LXL04_014094 · OH-1004

Cytoplasm0.359

Rank 2 · LXL04_014094 · OH-1004

Nucleus0.269

Rank 3 · LXL04_014094 · OH-1004

Endoplasmic reticulum0.044

Rank 4 · LXL04_014094 · OH-1004

Plastid0.043

Rank 5 · LXL04_014094 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I8B9`	Arabidopsis thaliana	Putative WEB family protein At1g65010, chloroplastic	26.585%	Swiss-Prot	weak database homology
`Q9M8T5`	Arabidopsis thaliana	WEB family protein At3g02930, chloroplastic	27.072%	Swiss-Prot	weak database homology
`Q9LFE4`	Arabidopsis thaliana	WEB family protein At5g16730, chloroplastic	27.074%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card