LXL04_013890 | RubberDandelionOmics

Gene overview

LXL04_013890

Reference: OH-1004 Chr: Chr03 Coordinates: 37567104-37570167 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

969 bp · LXL04_013890|LXL04_013890|OH1004|cDNA

ATGGCGTCCACCTCACAACAATCTTCTCCTCCTCTTCATTCCCTGAAAGCCCTTGTCGCCTTCCGCAACCTCATCTGTCCAGAGCTAATTAGGACGGTACATCTGTACCGATCGGAGGAAGGAGGGGAAGAAGTGGAGGTAGAAAGAGAGTATGTGTTTCATAAGGAGAGGGATTACGAGGAGATTAGCTTCTGTAAAGTGTTTACCTTGAAGAAATTTGAAGTTTCTTCACATTTTGAAGGGCTTGTGAATGGCGTATG...

CDS

Download CDS FASTA

969 bp · LXL04_013890|LXL04_013890|OH1004|CDS

ATGGCGTCCACCTCACAACAATCTTCTCCTCCTCTTCATTCCCTGAAAGCCCTTGTCGCCTTCCGCAACCTCATCTGTCCAGAGCTAATTAGGACGGTACATCTGTACCGATCGGAGGAAGGAGGGGAAGAAGTGGAGGTAGAAAGAGAGTATGTGTTTCATAAGGAGAGGGATTACGAGGAGATTAGCTTCTGTAAAGTGTTTACCTTGAAGAAATTTGAAGTTTCTTCACATTTTGAAGGGCTTGTGAATGGCGTATG...

Protein

Download Protein FASTA

322 aa · LXL04_013890|LXL04_013890|OH1004|PROTEIN

MASTSQQSSPPLHSLKALVAFRNLICPELIRTVHLYRSEEGGEEVEVEREYVFHKERDYEEISFCKVFTLKKFEVSSHFEGLVNGVWLCIYVFDATCSSPADIDRLPTVLTISRNQKLESIPTLANDLQTITQISCKGESEEDGEEDKDNRYKNHHMCDVDLNSLPYGLSENDESESATDVSGKKKRRAATKDIASLGLEDLAKYFDLPIIEASKNLKVGLTVLKKKCREFGIPRWPHRKIKSLDGLISDLQEEVKRQQE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013890`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013890

Location Chr03:37567104-37570167 (-)

Description Similar to RKD5: Protein RKD5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35590`	Putative transcription factor.	No verified direct reference in this release
`At1g18790`	Putative transcription factor.	No verified direct reference in this release
`At1g74480`	Putative transcription factor.	No verified direct reference in this release
`At5g66990`	Putative transcription factor.	No verified direct reference in this release
`At5g53040`	Putative transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013890 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0051302 regulation of cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G18790

ath:AT1G74480

ath:AT4G35590

ath:AT5G53040

ath:AT5G66990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.835

Rank 1 · LXL04_013890 · OH-1004

Cytoplasm0.206

Rank 2 · LXL04_013890 · OH-1004

Cell membrane0.046

Rank 3 · LXL04_013890 · OH-1004

Endoplasmic reticulum0.028

Rank 4 · LXL04_013890 · OH-1004

Mitochondrion0.025

Rank 5 · LXL04_013890 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02042.22RWP-RK190-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013890	`PF02042.22`	RWP-RK	190	287	1.3e-28	99.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81791`	Arabidopsis thaliana	Protein RKD5	46.224%	Swiss-Prot	moderate database homology
`Q9M9U9`	Arabidopsis thaliana	Protein RKD1	44.248%	Swiss-Prot	weak database homology
`Q9CA66`	Arabidopsis thaliana	Protein RKD2	44.248%	Swiss-Prot	weak database homology
`Q9FGD1`	Arabidopsis thaliana	Protein RKD3	37.500%	Swiss-Prot	weak database homology
`Q9LVU8`	Arabidopsis thaliana	Protein RKD4	41.228%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card