LXL04_013849 | RubberDandelionOmics

Gene overview

LXL04_013849

Reference: OH-1004 Chr: Chr03 Coordinates: 36862442-36865478 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1185 bp · LXL04_013849|LXL04_013849|OH1004|cDNA

ATGAGGAAAAGACTCGAGAAACATACAGATAGAGGTTTGTGTGTGTTTATGAGTGAGAAACATTATTCTACTTTtacttttctttttcttttgacTGTTCCTGCTGATGATCTTCTAATAAAGGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGGTGTGGG...

CDS

Download CDS FASTA

1185 bp · LXL04_013849|LXL04_013849|OH1004|CDS

ATGAGGAAAAGACTCGAGAAACATACAGATAGAGGTTTGTGTGTGTTTATGAGTGAGAAACATTATTCTACTTTTACTTTTCTTTTTCTTTTGACTGTTCCTGCTGATGATCTTCTAATAAAGGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGGTGTGGG...

Protein

Download Protein FASTA

394 aa · LXL04_013849|LXL04_013849|OH1004|PROTEIN

MRKRLEKHTDRGLCVFMSEKHYSTFTFLFLLTVPADDLLIKGHSLAIDESSMTGESKIAHKDQKSPFLMYGCKVADGAGTMMVTGVGINTEWGLLMASISDTGEETPLQVWLNGVATFIDIVSFIELCQKLDLLVMLRAGPYICAEWDFGGFPAWLLTKEPSIRLRSSDPVYLTLVDKWWGTLLPKIALLLYHKGGPIVMLQIENEFGSYGVDKDYLHHLVNLARSHLGDDLIFCFFLKDGKVYRKLSLIIPIFCMAHGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013849`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013849

Location Chr03:36862442-36865478 (+)

Description Similar to BGAL17: Beta-galactosidase 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72990`	Beta-galactosidase 17.	No verified direct reference in this release
`At3g21180`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0539400`	Beta-galactosidase 8.	No verified direct reference in this release
`Os04g0605500`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013849 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0019388 galactose catabolic process Biological Process

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004565 beta-galactosidase activity Molecular Function

GO:0005388 P-type calcium transporter activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G72990

ath:AT3G21180

dosa:Os05g0539400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.256

Rank 1 · LXL04_013849 · OH-1004

Cytoplasm0.213

Rank 2 · LXL04_013849 · OH-1004

Extracellular0.204

Rank 3 · LXL04_013849 · OH-1004

Lysosome / Vacuole0.137

Rank 4 · LXL04_013849 · OH-1004

Nucleus0.130

Rank 5 · LXL04_013849 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00122.26E1-E2_ATPase32-98 aa

PF01301.26Glyco_hydro_35119-233 aa

PF01301.26Glyco_hydro_35254-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013849	`PF00122.26`	E1-E2_ATPase	32	98	1.5e-08	35.0
LXL04_013849	`PF01301.26`	Glyco_hydro_35	119	233	9.5e-57	193.7
LXL04_013849	`PF01301.26`	Glyco_hydro_35	254	311	9.5e-57	193.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z24`	Arabidopsis thaliana	Beta-galactosidase 17	62.308%	Swiss-Prot	weak database homology
`Q9LU41`	Arabidopsis thaliana	Calcium-transporting ATPase 9, plasma membrane-type	86.813%	Swiss-Prot	weak database homology
`Q0DGD7`	Oryza sativa subsp. japonica	Beta-galactosidase 8	63.359%	Swiss-Prot	weak database homology
`Q7X8B5`	Oryza sativa subsp. japonica	Calcium-transporting ATPase 5, plasma membrane-type	83.516%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card