LXL04_013813 | RubberDandelionOmics

Gene overview

LXL04_013813

Reference: OH-1004 Chr: Chr03 Coordinates: 36314501-36317181 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · LXL04_013813|LXL04_013813|OH1004|cDNA

atgaagaccatgaaatcGGAAGGTGGTGAATGCAAAGTAACTCAAGCAGTTTTACATTACAGTACAAGTTGGTTCACGATCATGGACAAATTGGATCACCAATCATCATGTGTCCCTCCAGGGTTCCGTTTTCATCCTACCGATGAAGAACTTGTTGGATACTATCTCAGAAAGAAAGTTATGTCGCAGAAGATCGATCTTGATGTTATTAGGGATATCGATCTATATAGAATCGAACCATGGGATCTGATAGAGAAATG...

CDS

Download CDS FASTA

1149 bp · LXL04_013813|LXL04_013813|OH1004|CDS

ATGAAGACCATGAAATCGGAAGGTGGTGAATGCAAAGTAACTCAAGCAGTTTTACATTACAGTACAAGTTGGTTCACGATCATGGACAAATTGGATCACCAATCATCATGTGTCCCTCCAGGGTTCCGTTTTCATCCTACCGATGAAGAACTTGTTGGATACTATCTCAGAAAGAAAGTTATGTCGCAGAAGATCGATCTTGATGTTATTAGGGATATCGATCTATATAGAATCGAACCATGGGATCTGATAGAGAAATG...

Protein

Download Protein FASTA

382 aa · LXL04_013813|LXL04_013813|OH1004|PROTEIN

MKTMKSEGGECKVTQAVLHYSTSWFTIMDKLDHQSSCVPPGFRFHPTDEELVGYYLRKKVMSQKIDLDVIRDIDLYRIEPWDLIEKCRIGHEEQNEWYFFSYKDKKYPTGTRTNRATMAGFWKATGRDKAVYERLRLIGMRKTLVFYKGRAPNGQKTDWIMHEYRLESEENGPPQEEGWVVCRAFKKRPTGQSRTTKTWEPNYFYDESSCITSAMDDCITTQPSNFLSTQSFMCKKELEAAENLNFVHCDQFMELPQLEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013813`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013813

Location Chr03:36314501-36317181 (+)

Description Similar to NAC076: NAC domain-containing protein 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g36160`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	No verified direct reference in this release
`At2g18060`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At5g66300`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At1g12260`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At1g62700`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013813 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0048759 xylem vessel member cell differentiation Biological Process

GO:0071555 cell wall organization Biological Process

GO:1901348 positive regulation of secondary cell wall biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G12260

ath:AT1G62700

ath:AT2G18060

ath:AT4G36160

ath:AT5G66300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · LXL04_013813 · OH-1004

Cytoplasm0.097

Rank 2 · LXL04_013813 · OH-1004

Cell membrane0.039

Rank 3 · LXL04_013813 · OH-1004

Endoplasmic reticulum0.028

Rank 4 · LXL04_013813 · OH-1004

Plastid0.015

Rank 5 · LXL04_013813 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365.21NAM39-166 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013813	`PF02365.21`	NAM	39	166	3e-48	164.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65508`	Arabidopsis thaliana	NAC domain-containing protein 76	62.275%	Swiss-Prot	strong database homology
`Q9SL41`	Arabidopsis thaliana	NAC domain-containing protein 37	57.995%	Swiss-Prot	strong database homology
`Q9FH59`	Arabidopsis thaliana	NAC domain-containing protein 105	57.285%	Swiss-Prot	strong database homology
`Q9FWX2`	Arabidopsis thaliana	NAC domain-containing protein 7	51.811%	Swiss-Prot	strong database homology
`F4HYV5`	Arabidopsis thaliana	NAC domain-containing protein 26	48.837%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card