LXL04_013741 | RubberDandelionOmics

Gene overview

LXL04_013741

Reference: OH-1004 Chr: Chr03 Coordinates: 35151112-35151911 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

699 bp · LXL04_013741|LXL04_013741|OH1004|cDNA

ATGAACAGGTGCACTGGTTCAACCATGATGGGTCCTTGTTCTTGCGGTCTCTACCATTATCAACCGAACTCCTTCTCTTCCATATTTCCGATGCCTTACGAAGAAGAAATGTGCCCTTATTCTTCGTCGCCGTCGTCTGTGGATTGTACCTTGTCTTTGGGTACGCCGTCGACTCGCTTGACAAACGATAATGAAAAGCGTCGCGGCTCTAGTTGGTGGAACATTTTGCAATCGTCTAGCCACTCCGCCGCACCATCCGG...

CDS

Download CDS FASTA

699 bp · LXL04_013741|LXL04_013741|OH1004|CDS

ATGAACAGGTGCACTGGTTCAACCATGATGGGTCCTTGTTCTTGCGGTCTCTACCATTATCAACCGAACTCCTTCTCTTCCATATTTCCGATGCCTTACGAAGAAGAAATGTGCCCTTATTCTTCGTCGCCGTCGTCTGTGGATTGTACCTTGTCTTTGGGTACGCCGTCGACTCGCTTGACAAACGATAATGAAAAGCGTCGCGGCTCTAGTTGGTGGAACATTTTGCAATCGTCTAGCCACTCCGCCGCACCATCCGG...

Protein

Download Protein FASTA

232 aa · LXL04_013741|LXL04_013741|OH1004|PROTEIN

MNRCTGSTMMGPCSCGLYHYQPNSFSSIFPMPYEEEMCPYSSSPSSVDCTLSLGTPSTRLTNDNEKRRGSSWWNILQSSSHSAAPSGHKSNRGGDGSGSATADSLFSRRCANCDTTSTPLWRNGPRGPKSLCNACGIRYKKEERRANAAAAAAVSNGGSDSTEGYHHQYMMNGNQWMNHSQSSHKMPTCYSTASAASNEYRFMDEVDDRDSPFLSWRLNVTDRPGLVHDFTR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013741`
TK1151 ID	TkA02G474470
OH-1004 ID	LXL04_013741
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013741

Location Chr03:35151112-35151911 (+)

Description Similar to GATA18: GATA transcription factor 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50870`	Transcriptional factor that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters (including its own promoter and GATA21 promoter), thus regulating the expression of genes mostly involved in hormone responses and floral organ specification (including genes regulating hormones responses).	No verified direct reference in this release
`At4g36620`	Transcriptional regulator that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters.	Transcription repressor HANABA TARANU controls flower development by integrating the actions of multiple hormones, floral organ specification genes, and GATA3 family genes in Arabidopsis.2013 · DOI: 10.1105/tpc.112.107854
`At2g18380`	Transcriptional regulator that specifically binds 5'-GATA-3' or 5'-GAT-3' motifs within gene promoters.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0578900`	Probable transcription factor that regulates organogenesis during transition from the vegetative to the reproductive phase.	No verified direct reference in this release
`UniProt: B8AX51`	Probable transcription factor that regulates organogenesis during transition from the vegetative to the reproductive phase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013741 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0048437 floral organ development Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0048825 cotyledon development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT2G18380

ath:AT3G50870

ath:AT4G36620

dosa:Os05g0578900

osa:4339709

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · LXL04_013741 · OH-1004

Cytoplasm0.097

Rank 2 · LXL04_013741 · OH-1004

Cell membrane0.035

Rank 3 · LXL04_013741 · OH-1004

Endoplasmic reticulum0.024

Rank 4 · LXL04_013741 · OH-1004

Plastid0.014

Rank 5 · LXL04_013741 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00320.34GATA110-144 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013741	`PF00320.34`	GATA	110	144	2.4e-17	62.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LC79`	Arabidopsis thaliana	GATA transcription factor 18	41.754%	Swiss-Prot	moderate database homology
`Q6QPM2`	Arabidopsis thaliana	GATA transcription factor 19	46.288%	Swiss-Prot	moderate database homology
`Q9ZPX0`	Arabidopsis thaliana	GATA transcription factor 20	51.923%	Swiss-Prot	moderate database homology
`Q6L5E5`	Oryza sativa subsp. japonica	GATA transcription factor 15	45.902%	Swiss-Prot	weak database homology
`B8AX51`	Oryza sativa subsp. indica	GATA transcription factor 15	45.902%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card