LXL04_013626 | RubberDandelionOmics

Gene overview

LXL04_013626

Reference: OH-1004 Chr: Chr03 Coordinates: 33012571-33014133 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1563 bp · LXL04_013626|LXL04_013626|OH1004|cDNA

ATGGATACTATGTTCACCctccaacaccaacaccaacaccaacatcatcatcatcctcatcGTCAATCTTTCAACTCCACCGTCAGTTCTAGCAGTTCCAGGTCCTCCGCCGATCAAATTCAAACAACCACCGCCCATTACCACCACCCACAAGAAGAATGTTTCACTCCGTTTTTCATGGAAGAAGACgatctctcttcttcttcctcactgCAACAGTACTATAACTCTCCTCACCAGTTACAACAACCCCATGATTT...

CDS

Download CDS FASTA

1563 bp · LXL04_013626|LXL04_013626|OH1004|CDS

ATGGATACTATGTTCACCCTCCAACACCAACACCAACACCAACATCATCATCATCCTCATCGTCAATCTTTCAACTCCACCGTCAGTTCTAGCAGTTCCAGGTCCTCCGCCGATCAAATTCAAACAACCACCGCCCATTACCACCACCCACAAGAAGAATGTTTCACTCCGTTTTTCATGGAAGAAGACGATCTCTCTTCTTCTTCCTCACTGCAACAGTACTATAACTCTCCTCACCAGTTACAACAACCCCATGATTT...

Protein

Download Protein FASTA

520 aa · LXL04_013626|LXL04_013626|OH1004|PROTEIN

MDTMFTLQHQHQHQHHHHPHRQSFNSTVSSSSSRSSADQIQTTTAHYHHPQEECFTPFFMEEDDLSSSSSLQQYYNSPHQLQQPHDFHHQFSATPTPTSTATPPPPLKTSHGFSNEHSNFNFSSSQNVAMEFSNSFSANGWASDVLLEAARAVADKNSSRLQQLMWMLNELSSPYGDVDEKLCCYFLQALHSRMTDSGELNYRNLSSVSEKMCTFESTRELVLKFQEVSPWTTFGHVACNGAILEALDGETKLHIVDISN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013626`
TK1151 ID	TkA02G483470
OH-1004 ID	LXL04_013626
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 75.192 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013626

Location Chr03:33012571-33014133 (+)

Description Similar to SHR: Protein SHORT-ROOT

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g37650`	Transcription factor required for quiescent center cells specification and maintenance of surrounding stem cells, and for the asymmetric cell division involved in radial pattern formation in roots.	Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis thaliana.1998 · DOI: 10.1046/j.1365-313x.1998.00137.x
`At3g49950`	Probable transcription factor involved in plant development.	No verified direct reference in this release
`At2g04890`	Probable transcription factor involved in plant development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YN56`	Transcription factor required for the asymmetric cell division involved in radial pattern formation in roots.	No verified direct reference in this release
`Os07g0586900`	Transcription factor required for the asymmetric cell division involved in radial pattern formation in roots.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013626 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0009956 radial pattern formation Biological Process

GO:0032350 regulation of hormone metabolic process Biological Process

GO:0045930 negative regulation of mitotic cell cycle Biological Process

GO:0048366 leaf development Biological Process

GO:0060586 multicellular organismal-level iron ion homeostasis Biological Process

GO:0005634 nucleus Cellular Component

GO:0005769 early endosome Cellular Component

GO:0005770 late endosome Cellular Component

GO:0055037 recycling endosome Cellular Component

KEGG gene cross-reference

ath:AT2G04890

ath:AT3G49950

ath:AT4G37650

dosa:Os07g0586900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.860

Rank 1 · LXL04_013626 · OH-1004

Cytoplasm0.188

Rank 2 · LXL04_013626 · OH-1004

Cell membrane0.053

Rank 3 · LXL04_013626 · OH-1004

Endoplasmic reticulum0.034

Rank 4 · LXL04_013626 · OH-1004

Plastid0.023

Rank 5 · LXL04_013626 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03514.21GRAS144-518 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013626	`PF03514.21`	GRAS	144	518	2.6e-95	320.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZF7`	Arabidopsis thaliana	Protein SHORT-ROOT	57.685%	Swiss-Prot	strong database homology
`Q9SN22`	Arabidopsis thaliana	Scarecrow-like protein 32	31.458%	Swiss-Prot	moderate database homology
`Q9S7H5`	Arabidopsis thaliana	Scarecrow-like protein 21	31.414%	Swiss-Prot	moderate database homology
`A2YN56`	Oryza sativa subsp. indica	Protein SHORT-ROOT 1	54.369%	Swiss-Prot	strong database homology
`Q8H2X8`	Oryza sativa subsp. japonica	Protein SHORT-ROOT 1	54.369%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card