LXL04_013587 | RubberDandelionOmics

Gene overview

LXL04_013587

Reference: OH-1004 Chr: Chr03 Coordinates: 32164630-32167722 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

822 bp · LXL04_013587|LXL04_013587|OH1004|cDNA

ATGATTGTGATCAGTGAGTCGATCTTCGTTTTTTTGGGGAAAGCTCTGCTTCGCGAATCGCGACCTCACCTCAGCTCCGACCACCACGCCGACGAACTCCACTCCGACGCGTCCTCCGCTCGGCTCCGACCACCATTCCGACGCGACCTCCACtccgacgacctcgacgaccAGCTACACTTCTCCCTCTTCTCTCTCGCTGCTTTTCCTCCGGCGACCTACAGTTACGCTTCCAGCTACACTTCTCCCTCTTCTCTCTC...

CDS

Download CDS FASTA

822 bp · LXL04_013587|LXL04_013587|OH1004|CDS

ATGATTGTGATCAGTGAGTCGATCTTCGTTTTTTTGGGGAAAGCTCTGCTTCGCGAATCGCGACCTCACCTCAGCTCCGACCACCACGCCGACGAACTCCACTCCGACGCGTCCTCCGCTCGGCTCCGACCACCATTCCGACGCGACCTCCACTCCGACGACCTCGACGACCAGCTACACTTCTCCCTCTTCTCTCTCGCTGCTTTTCCTCCGGCGACCTACAGTTACGCTTCCAGCTACACTTCTCCCTCTTCTCTCTC...

Protein

Download Protein FASTA

273 aa · LXL04_013587|LXL04_013587|OH1004|PROTEIN

MIVISESIFVFLGKALLRESRPHLSSDHHADELHSDASSARLRPPFRRDLHSDDLDDQLHFSLFSLAAFPPATYSYASSYTSPSSLSLLFLRRPTGMFCSPKANSSRKVAAASGDARRALEICRRAAELADYRVKNSISIPKDGKCLVGMGEVEAAIQEMFQAPHIQVMRNCSKLSKVFLVAMVHELYKTGMSETTFEKLAQIVSSLCTSNGITFPGWDTLLRIGCKLGESRIILCESGASHRFQKLQLNFLSDDVSFAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013587`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013587

Location Chr03:32164630-32167722 (-)

Description Similar to ORC1B: Origin of replication complex subunit 1B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g12620`	Essential protein required for ovules fertilization.	No verified direct reference in this release
`At4g14700`	Essential protein.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0187000`	Essential protein (By similarity).	Molecular cloning and characterization of a plant homologue of the origin recognition complex 1 (ORC1).2000 · DOI: 10.1016/s0168-9452(00)00297-1

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013587 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006270 DNA replication initiation Biological Process

GO:0006277 DNA amplification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009744 response to sucrose Biological Process

GO:0033314 mitotic DNA replication checkpoint signaling Biological Process

GO:0048661 positive regulation of smooth muscle cell proliferation Biological Process

GO:0070318 positive regulation of G0 to G1 transition Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0000808 origin recognition complex Cellular Component

KEGG gene cross-reference

ath:AT4G12620

ath:AT4G14700

dme:Dmel_CG10667

dosa:Os06g0187000

rno:313479

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.518

Rank 1 · LXL04_013587 · OH-1004

Cytoplasm0.352

Rank 2 · LXL04_013587 · OH-1004

Mitochondrion0.094

Rank 3 · LXL04_013587 · OH-1004

Cell membrane0.044

Rank 4 · LXL04_013587 · OH-1004

Endoplasmic reticulum0.043

Rank 5 · LXL04_013587 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17872.8AAA_lid_10105-136 aa

PF09079.18WHD_Cdc6167-259 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013587	`PF17872.8`	AAA_lid_10	105	136	1.9e-07	31.9
LXL04_013587	`PF09079.18`	WHD_Cdc6	167	259	9.4e-09	35.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SU24`	Arabidopsis thaliana	Origin of replication complex subunit 1B	70.414%	Swiss-Prot	moderate database homology
`Q710E8`	Arabidopsis thaliana	Origin of replication complex subunit 1A	69.822%	Swiss-Prot	moderate database homology
`Q5SMU7`	Oryza sativa subsp. japonica	Origin of replication complex subunit 1	65.497%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card