LXL04_013447 | RubberDandelionOmics

Gene overview

LXL04_013447

Reference: OH-1004 Chr: Chr03 Coordinates: 29829488-29835010 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1683 bp · LXL04_013447|LXL04_013447|OH1004|cDNA

ATGCTTAGTGGATGTACCGTTTATACGAATGGATTCGAAATCACAAGCTCTTCTCTCCGCCAGACTTCttcctctccctctctcctccCTGTCTCCGGACTTCCCCTCCTCACCGGAATCGGTCGTTCTCCTTTCCGCCGCCTTCTTAATCACGCTGTACGGGATCGGAGACTAGCGTTGCCTTTGTGCTCTGTCTCTTCTCCTCTCCGCCTGCATCAGAAAGAAACCATGGCTGAACAGAAGCTAACAAGAATAGGCCT...

CDS

Download CDS FASTA

1683 bp · LXL04_013447|LXL04_013447|OH1004|CDS

ATGCTTAGTGGATGTACCGTTTATACGAATGGATTCGAAATCACAAGCTCTTCTCTCCGCCAGACTTCTTCCTCTCCCTCTCTCCTCCCTGTCTCCGGACTTCCCCTCCTCACCGGAATCGGTCGTTCTCCTTTCCGCCGCCTTCTTAATCACGCTGTACGGGATCGGAGACTAGCGTTGCCTTTGTGCTCTGTCTCTTCTCCTCTCCGCCTGCATCAGAAAGAAACCATGGCTGAACAGAAGCTAACAAGAATAGGCCT...

Protein

Download Protein FASTA

560 aa · LXL04_013447|LXL04_013447|OH1004|PROTEIN

MLSGCTVYTNGFEITSSSLRQTSSSPSLLPVSGLPLLTGIGRSPFRRLLNHAVRDRRLALPLCSVSSPLRLHQKETMAEQKLTRIGLAGLAVMGQNLALNIAEKGFPISVYNRSTNKVDETVERAQKEGNLPLFGFHDPESFVKSIQKPRSIIMLVKAGAPVDQTIKTLSQYMEKGDCIIDGGNEWYENTERREKEMAELGLLYLGMGVSGGEEGARNGPSMMPGGSIEAYKYIEDIVLKVAAQVPDSGPCVTYIGEGGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013447`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013447

Location Chr03:29829488-29835010 (+)

Description Similar to PGD2: 6-phosphogluconate dehydrogenase, decarboxylating 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02360`	May catalyze oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO₂ while reducing NADP to NADPH.	Defects in Peroxisomal 6-Phosphogluconate Dehydrogenase Isoform PGD2 Prevent Gametophytic Interaction in Arabidopsis thaliana.2016 · DOI: 10.1104/pp.15.01301
`At5g41670`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release
`At1g64190`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0111500`	Catalyzes the oxidative decarboxylation of 6-phosphogluconate to ribulose 5-phosphate and CO(2), with concomitant reduction of NADP to NADPH.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013447 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009051 pentose-phosphate shunt, oxidative branch Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009744 response to sucrose Biological Process

GO:0009749 response to glucose Biological Process

GO:0009750 response to fructose Biological Process

GO:0019521 D-gluconate metabolic process Biological Process

GO:0080173 male-female gamete recognition during double fertilization forming a zygote and endosperm Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G64190

ath:AT3G02360

ath:AT5G41670

dosa:Os06g0111500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.662

Rank 1 · LXL04_013447 · OH-1004

Cytoplasm0.249

Rank 2 · LXL04_013447 · OH-1004

Peroxisome0.143

Rank 3 · LXL04_013447 · OH-1004

Mitochondrion0.102

Rank 4 · LXL04_013447 · OH-1004

Nucleus0.069

Rank 5 · LXL04_013447 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03446.22NAD_binding_284-256 aa

PF00393.256PGD261-551 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013447	`PF03446.22`	NAD_binding_2	84	256	1.9e-45	155.5
LXL04_013447	`PF00393.25`	6PGD	261	551	1.6e-127	425.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FWA3`	Arabidopsis thaliana	6-phosphogluconate dehydrogenase, decarboxylating 2	87.448%	Swiss-Prot	strong database homology
`Q9FFR3`	Arabidopsis thaliana	6-phosphogluconate dehydrogenase, decarboxylating 3, chloroplastic	76.337%	Swiss-Prot	strong database homology
`Q9SH69`	Arabidopsis thaliana	6-phosphogluconate dehydrogenase, decarboxylating 1, chloroplastic	76.132%	Swiss-Prot	strong database homology
`Q9LI00`	Oryza sativa subsp. japonica	6-phosphogluconate dehydrogenase, decarboxylating 1	84.842%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card