RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_013107
Reference: OH-1004 Chr: Chr03 Coordinates: 24239178-24241265 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1617 bp · LXL04_013107|LXL04_013107|OH1004|cDNA

ATGGCGGAAGATAATAATAGAAGAAACGGCGGCACTGGAGACGATCGGAGCGAGACGAGTGATTACACATCGGAGGACGAAGGAACGGAGGATTACAGGCGTGGAGGGTATCATGCTGTTCGTATTGGTGATAAATTTAAGCATTCGAGATATATTGTTCAGAGCAAGCTCGGTTGGGGTCATTTTTCCACTGTTTGGCTCGCTTGGGACACTCATAAATCCAGATATGTAGCTTTAAAAGTTCAAAAGAGTGCACAACA...

CDS

Download CDS FASTA

1617 bp · LXL04_013107|LXL04_013107|OH1004|CDS

ATGGCGGAAGATAATAATAGAAGAAACGGCGGCACTGGAGACGATCGGAGCGAGACGAGTGATTACACATCGGAGGACGAAGGAACGGAGGATTACAGGCGTGGAGGGTATCATGCTGTTCGTATTGGTGATAAATTTAAGCATTCGAGATATATTGTTCAGAGCAAGCTCGGTTGGGGTCATTTTTCCACTGTTTGGCTCGCTTGGGACACTCATAAATCCAGATATGTAGCTTTAAAAGTTCAAAAGAGTGCACAACA...

Protein

Download Protein FASTA

538 aa · LXL04_013107|LXL04_013107|OH1004|PROTEIN

MAEDNNRRNGGTGDDRSETSDYTSEDEGTEDYRRGGYHAVRIGDKFKHSRYIVQSKLGWGHFSTVWLAWDTHKSRYVALKVQKSAQHYTEAAMDEITILKQIAEGDPDDQKAVVKLLDHFKHSGPNGQHVCMVFEYLGDNLLTLIKYSDYRGIPLPKVKEICFHILGGLDYLHRQLSIIHTDLKPENILLLSMIDPERDRTKSGTPLILSTTKDLPSDSNSSKEPKPSPSSSNGDLTKNQKKKNKKKAKKAAQNGSGRED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_013107
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_013107
LocationChr03:24239178-24241265 (+)
DescriptionSimilar to dsk1: Protein kinase dsk1 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_013107 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000245 spliceosomal complex assembly Biological Process
GO:0006468 protein phosphorylation Biological Process
GO:0007059 chromosome segregation Biological Process
GO:0007088 regulation of mitotic nuclear division Biological Process
GO:0008380 RNA splicing Biological Process
GO:0018105 peptidyl-serine phosphorylation Biological Process
GO:0030154 cell differentiation Biological Process
GO:0035092 sperm DNA condensation Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0045070 positive regulation of viral genome replication Biological Process
GO:0045071 negative regulation of viral genome replication Biological Process
GO:0045087 innate immune response Biological Process
KEGG gene cross-reference
hsa:6732
pon:100172042
spo:2539847
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.632
Rank 1 · LXL04_013107 · OH-1004
Cytoplasm0.436
Rank 2 · LXL04_013107 · OH-1004
Cell membrane0.053
Rank 3 · LXL04_013107 · OH-1004
Mitochondrion0.044
Rank 4 · LXL04_013107 · OH-1004
Endoplasmic reticulum0.028
Rank 5 · LXL04_013107 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase51-191 aa
PF07714.24PK_Tyr_Ser-Thr54-190 aa
PF00069.32Pkinase314-482 aa
PF07714.24PK_Tyr_Ser-Thr315-376 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_013107PF00069.32Pkinase511918.9e-43147.3
LXL04_013107PF07714.24PK_Tyr_Ser-Thr541902.2e-1764.0
LXL04_013107PF00069.32Pkinase3144828.9e-43147.3
LXL04_013107PF07714.24PK_Tyr_Ser-Thr3153762.2e-1764.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser