LXL04_013034 | RubberDandelionOmics

Gene overview

LXL04_013034

Reference: OH-1004 Chr: Chr03 Coordinates: 22823670-22831718 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3636 bp · LXL04_013034|LXL04_013034|OH1004|cDNA

ATGAAGATAGAAGAAGTGCAATCTACTACTAAGAAGCAGAGGATCGCTACGCACACTCATATCAAAGGCCTTGGTCTTGAGCCTACTGGAAAAGCAATCCCATTGGCGGCTGGATTTGTAGGTCAATCAGCAGCAAGAGAGGCCGGCGGCCTTGTAGTTGACATGATCCGCCAAAAAAAGATGGCTGGACGTGCACTTCTGTTTGCCGGACCTCCTGGAACTGGCAAAACCGCCCTTGCCCTTGGCATCTCCCAAGAACT...

CDS

Download CDS FASTA

3636 bp · LXL04_013034|LXL04_013034|OH1004|CDS

ATGAAGATAGAAGAAGTGCAATCTACTACTAAGAAGCAGAGGATCGCTACGCACACTCATATCAAAGGCCTTGGTCTTGAGCCTACTGGAAAAGCAATCCCATTGGCGGCTGGATTTGTAGGTCAATCAGCAGCAAGAGAGGCCGGCGGCCTTGTAGTTGACATGATCCGCCAAAAAAAGATGGCTGGACGTGCACTTCTGTTTGCCGGACCTCCTGGAACTGGCAAAACCGCCCTTGCCCTTGGCATCTCCCAAGAACT...

Protein

Download Protein FASTA

1211 aa · LXL04_013034|LXL04_013034|OH1004|PROTEIN

MKIEEVQSTTKKQRIATHTHIKGLGLEPTGKAIPLAAGFVGQSAAREAGGLVVDMIRQKKMAGRALLFAGPPGTGKTALALGISQELGTKVPFCPMVGSEVYSSEVKKTEVLMENFRRAIGLRIKENKEVYEGEVTELSPEETESVTGGYGKAISHVIIGLKTVKGTKQLKLDPTIYDALIKEKVAVGDVIYIEANSGAVKRVGRSDAFATEYDLEAEEYVPLPKGEVHKKKEIVQDVTLHDLDAANARPQGGQDILSLM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013034`
TK1151 ID	TkA02G520890
OH-1004 ID	LXL04_013034
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013034

Location Chr03:22823670-22831718 (+)

Description Similar to ISPG: 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60600`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-2,4cPP) into 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate.	CHLOROPLAST BIOGENESIS genes act cell and noncell autonomously in early chloroplast development.2004 · DOI: 10.1104/pp.103.036996 The Arabidopsis csb3 mutant reveals a regulatory link between salicylic acid-mediated disease resistance and the methyl-erythritol 4-phosphate pathway.2005 · DOI: 10.1111/j.1365-313x.2005.02517.x Isoprenoid biosynthesis in plant chloroplasts via the MEP pathway: direct thylakoid/ferredoxin-dependent photoreduction of GcpE/IspG.2006 · DOI: 10.1016/j.febslet.2006.01.082
`At5g22330`	Proposed core component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0603800`	Enzyme of the plastid non-mevalonate pathway for isoprenoid biosynthesis that converts 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-2,4cPP) into 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013034 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000492 box C/D snoRNP assembly Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009862 systemic acquired resistance, salicylic acid mediated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0019288 isopentenyl diphosphate biosynthetic process, methylerythritol 4-phosphate pathway Biological Process

GO:0030154 cell differentiation Biological Process

KEGG gene cross-reference

ath:AT5G22330

ath:AT5G60600

dosa:Os02g0603800

pcu:PC_RS03560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.634

Rank 1 · LXL04_013034 · OH-1004

Nucleus0.263

Rank 2 · LXL04_013034 · OH-1004

Mitochondrion0.136

Rank 3 · LXL04_013034 · OH-1004

Cell membrane0.090

Rank 4 · LXL04_013034 · OH-1004

Endoplasmic reticulum0.080

Rank 5 · LXL04_013034 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06068.20TIP4914-365 aa

PF05496.19RuvB_N38-91 aa

PF00004.36AAA66-115 aa

PF17856.8TIP49_C373-432 aa

PF04551.20GcpE558-827 aa

PF26540.1GcpE_C1111-1199 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013034	`PF06068.20`	TIP49	14	365	3.5e-164	546.8
LXL04_013034	`PF05496.19`	RuvB_N	38	91	8.6e-09	36.1
LXL04_013034	`PF00004.36`	AAA	66	115	5.2e-10	40.6
LXL04_013034	`PF17856.8`	TIP49_C	373	432	5.3e-15	56.0
LXL04_013034	`PF04551.20`	GcpE	558	827	1.2e-88	297.6
LXL04_013034	`PF26540.1`	GcpE_C	1111	1199	7.4e-24	84.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K0E8`	Arabidopsis thaliana	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic	83.919%	Swiss-Prot	moderate database homology
`Q9FMR9`	Arabidopsis thaliana	RuvB-like protein 1	88.009%	Swiss-Prot	weak database homology
`Q6K8J4`	Oryza sativa subsp. japonica	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin), chloroplastic	82.258%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card