LXL04_012375 | RubberDandelionOmics

Gene overview

LXL04_012375

Reference: OH-1004 Chr: Chr03 Coordinates: 11294172-11295558 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

606 bp · LXL04_012375|LXL04_012375|OH1004|cDNA

ATGGCCAGCAATTTCTCCGCCAGTAAGAATTTAGGAGGTATGGCTGAAGCAATTGATTTGACCGGAGATGGAGGTGTGATGAAGACAATTGTGAAGAGAGCCAAACCTGATGCAATTGCTCCTTCTGAGAACCTTCCTCTTGTTGATGTGCATTATGAAGGAACACTGGAAGAAACAGGTGAAGTTTTTGATACCACACATGAAGACAACACAATCTTCAGCTTTGAATTAGGGAAGGGGTCTGTGATAAAAGCTTGGGA...

CDS

Download CDS FASTA

606 bp · LXL04_012375|LXL04_012375|OH1004|CDS

ATGGCCAGCAATTTCTCCGCCAGTAAGAATTTAGGAGGTATGGCTGAAGCAATTGATTTGACCGGAGATGGAGGTGTGATGAAGACAATTGTGAAGAGAGCCAAACCTGATGCAATTGCTCCTTCTGAGAACCTTCCTCTTGTTGATGTGCATTATGAAGGAACACTGGAAGAAACAGGTGAAGTTTTTGATACCACACATGAAGACAACACAATCTTCAGCTTTGAATTAGGGAAGGGGTCTGTGATAAAAGCTTGGGA...

Protein

Download Protein FASTA

201 aa · LXL04_012375|LXL04_012375|OH1004|PROTEIN

MASNFSASKNLGGMAEAIDLTGDGGVMKTIVKRAKPDAIAPSENLPLVDVHYEGTLEETGEVFDTTHEDNTIFSFELGKGSVIKAWDVALKTMKVGEVAKITCKSDYAYGSAGSPPEIPPNATLVFEVELVACRPRKGSSVASASDERARLDELKRQREMAAAQKEEEKKKREEAKAAAAARIQAKMDAKKGGGKGKGKGK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012375`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012375

Location Chr03:11294172-11295558 (+)

Description Similar to FKBP20-1: Peptidyl-prolyl cis-trans isomerase FKBP20-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55520`	PPIases accelerate the folding of proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012375 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0006463 steroid hormone receptor complex assembly Biological Process

GO:0006825 copper ion transport Biological Process

GO:0030521 androgen receptor signaling pathway Biological Process

GO:0031111 negative regulation of microtubule polymerization or depolymerization Biological Process

GO:0031115 negative regulation of microtubule polymerization Biological Process

GO:0031503 protein-containing complex localization Biological Process

GO:0046661 male sex differentiation Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G55520

hsa:2288

mmu:14228

ocu:100009148

rno:260321

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.661

Rank 1 · LXL04_012375 · OH-1004

Nucleus0.432

Rank 2 · LXL04_012375 · OH-1004

Cell membrane0.083

Rank 3 · LXL04_012375 · OH-1004

Endoplasmic reticulum0.069

Rank 4 · LXL04_012375 · OH-1004

Mitochondrion0.050

Rank 5 · LXL04_012375 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00254.35FKBP_C47-131 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012375	`PF00254.35`	FKBP_C	47	131	1.2e-30	106.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2S7`	Arabidopsis thaliana	Peptidyl-prolyl cis-trans isomerase FKBP20-1	76.571%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card