LXL04_012257 | RubberDandelionOmics

Gene overview

LXL04_012257

Reference: OH-1004 Chr: Chr03 Coordinates: 9160912-9163126 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1377 bp · LXL04_012257|LXL04_012257|OH1004|cDNA

ATGAGTGATGAACCTCACCCCATACTCTTCCATCAACACCATATCTATCTATTCAACCACTGCCACGTGTCATCCCCATCGTCTCCTGCTTATCTGTTGAAAGACCTCTTACTTCAAAAAAAACACCACTAAACTCAATAACACTCTCCTTCTCCCTCTGCTTCACCTTCGAAGCTTAAAAAAACCAGATCAAAAATGGAGACAGGGGTAGCATGCTTCGCACGTGCCACAATCTTGCCAAGTGTGGCTTCTCAACATAC...

CDS

Download CDS FASTA

1182 bp · LXL04_012257|LXL04_012257|OH1004|CDS

ATGGAGACAGGGGTAGCATGCTTCGCACGTGCCACAATCTTGCCAAGTGTGGCTTCTCAACATACAACCAGCTCATTCGCCTCTCCACGCACCATTTCCCCCTCTTTCGCCACCAGAAGTTTAAAATCAAGCTCGTTATTTGGAGAGGCTTTGCGGGTGATGCCAAGATCGTCGCTCAAGGTCTCAAAGTCACAGAGTTCCGCAGTCGTACCCAAATGTGAAATCGGTGAAAGTCTGGAAGAGTTTCTATCGAAGGCAAC...

Protein

Download Protein FASTA

393 aa · LXL04_012257|LXL04_012257|OH1004|PROTEIN

METGVACFARATILPSVASQHTTSSFASPRTISPSFATRSLKSSSLFGEALRVMPRSSLKVSKSQSSAVVPKCEIGESLEEFLSKATTDKGLIRVMMCMGEAIRTIAFKVRTASCGGTACVNSFGDEQLAVDMLADKLLFDALSHSHFCKYACSEEVPELQDMGGPVEGGFSVAFDPLDGSSIVDTNFTVGTIFGVWPGDKLTGVTGGDQVAAAMGIYGPRTTYVIAIKGVPGTHEFLLLDEGKWQHVKETTEISEGKMF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012257`
TK1151 ID	TkA02G578210
OH-1004 ID	LXL04_012257
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 85.808 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012257

Location Chr03:9160912-9163126 (+)

Description Similar to At3g55800: Sedoheptulose-1,7-bisphosphatase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55800`	Sedoheptulose-1,7-bisphosphatase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012257 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005986 sucrose biosynthetic process Biological Process

GO:0006000 fructose metabolic process Biological Process

GO:0006002 fructose 6-phosphate metabolic process Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0016051 carbohydrate biosynthetic process Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0019253 reductive pentose-phosphate cycle Biological Process

GO:0030388 fructose 1,6-bisphosphate metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT3G55800

gbm:Gbem_2410

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.976

Rank 1 · LXL04_012257 · OH-1004

Mitochondrion0.030

Rank 2 · LXL04_012257 · OH-1004

Cytoplasm0.030

Rank 3 · LXL04_012257 · OH-1004

Peroxisome0.027

Rank 4 · LXL04_012257 · OH-1004

Nucleus0.016

Rank 5 · LXL04_012257 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00316.26FBPase70-250 aa

PF18913.6FBPase_C256-376 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012257	`PF00316.26`	FBPase	70	250	4.5e-56	190.2
LXL04_012257	`PF18913.6`	FBPase_C	256	376	1.2e-37	129.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P46283`	Arabidopsis thaliana	Sedoheptulose-1,7-bisphosphatase, chloroplastic	80.759%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card