LXL04_012242 | RubberDandelionOmics

Gene overview

LXL04_012242

Reference: OH-1004 Chr: Chr03 Coordinates: 8984253-8986949 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1746 bp · LXL04_012242|LXL04_012242|OH1004|cDNA

ATGATGAACTGGATCGAGAATACAGACTGTTGCAAGTGGGGTGGTATCACTTGCAACCACTTAACAGGTGATGTCATTGGTATTGACCTCAGTTGTGGAATGTTACGGGGTACCATCCACCCAAACACCACCCTTTTTCACCTTCCTCATCTCCAAACACTCAACCTCGCTTTCAATAAATTTTCACCTTCCCAACTTCCACGTGAGATTGGTGGGCTTTCCAAAAGTCTCACACTTCTCAACCTCTCTTATAGTGGGCT...

CDS

Download CDS FASTA

1746 bp · LXL04_012242|LXL04_012242|OH1004|CDS

ATGATGAACTGGATCGAGAATACAGACTGTTGCAAGTGGGGTGGTATCACTTGCAACCACTTAACAGGTGATGTCATTGGTATTGACCTCAGTTGTGGAATGTTACGGGGTACCATCCACCCAAACACCACCCTTTTTCACCTTCCTCATCTCCAAACACTCAACCTCGCTTTCAATAAATTTTCACCTTCCCAACTTCCACGTGAGATTGGTGGGCTTTCCAAAAGTCTCACACTTCTCAACCTCTCTTATAGTGGGCT...

Protein

Download Protein FASTA

581 aa · LXL04_012242|LXL04_012242|OH1004|PROTEIN

MMNWIENTDCCKWGGITCNHLTGDVIGIDLSCGMLRGTIHPNTTLFHLPHLQTLNLAFNKFSPSQLPREIGGLSKSLTLLNLSYSGLTVDIPWEILYLSKLVSLDLSSNYGLQIQPSVLKNLLRNFMHLRELLLSEVDISWVLPRYLNISTSLKSLDLSYTDLQGKLPDNIFSLHYLEKLDMSNNDYITGPWPNVNKSNNIPLKWLDLSYTNLSGEIPKSVGHLKFLNNLRLNSCGLVGSIPKYLVNMRHLTTLDLSSNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012242`
TK1151 ID	TkA02G579010
OH-1004 ID	LXL04_012242
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	93.600
Protein coverage (%)	TK1151 77.778 / OH-1004 34.940 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012242

Location Chr03:8984253-8986949 (-)

Description Similar to 9DC3: Receptor-like protein 9DC3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g28890`	Receptor-like protein 43.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012242 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G28890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.853

Rank 1 · LXL04_012242 · OH-1004

Endoplasmic reticulum0.094

Rank 2 · LXL04_012242 · OH-1004

Cytoplasm0.062

Rank 3 · LXL04_012242 · OH-1004

Nucleus0.045

Rank 4 · LXL04_012242 · OH-1004

Extracellular0.025

Rank 5 · LXL04_012242 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23598.2LRR_1444-134 aa

PF23598.2LRR_14201-311 aa

PF12799.14LRR_4397-433 aa

PF13855.13LRR_8397-452 aa

PF23598.2LRR_14400-472 aa

PF13855.13LRR_8434-476 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012242	`PF23598.2`	LRR_14	44	134	3.6e-22	79.3
LXL04_012242	`PF23598.2`	LRR_14	201	311	3.6e-22	79.3
LXL04_012242	`PF12799.14`	LRR_4	397	433	1.3e-25	89.5
LXL04_012242	`PF13855.13`	LRR_8	397	452	2.2e-25	88.9
LXL04_012242	`PF23598.2`	LRR_14	400	472	3.6e-22	79.3
LXL04_012242	`PF13855.13`	LRR_8	434	476	2.2e-25	88.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJW7`	Arabidopsis thaliana	Receptor-like protein 43	34.013%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card