RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_012224
Reference: OH-1004 Chr: Chr03 Coordinates: 8603118-8605571 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1413 bp · LXL04_012224|LXL04_012224|OH1004|cDNA

aTGCATCCCCTTCGCCGGAAAGTCTCCCTCTTCTCCTCCTACACCGCCGCCATGAAACAACGCAAAAACAACAACCTGTCCGTCTTCGTCGTCGTCTTCTCTATTTTCCTATTCGGGTTCTTCATGTACAATGAAGACGTCAAATCCATAGCCGAATTTCCATTCTCCAGGCCTAAATTCGCAACCCACGAAACTTCTATTCAGAAATCGAACGTTGACGGGGTGGTCGAGATCAGTTCCAGAACGACTTTAGTGGTGGA...

CDS

Download CDS FASTA

1413 bp · LXL04_012224|LXL04_012224|OH1004|CDS

ATGCATCCCCTTCGCCGGAAAGTCTCCCTCTTCTCCTCCTACACCGCCGCCATGAAACAACGCAAAAACAACAACCTGTCCGTCTTCGTCGTCGTCTTCTCTATTTTCCTATTCGGGTTCTTCATGTACAATGAAGACGTCAAATCCATAGCCGAATTTCCATTCTCCAGGCCTAAATTCGCAACCCACGAAACTTCTATTCAGAAATCGAACGTTGACGGGGTGGTCGAGATCAGTTCCAGAACGACTTTAGTGGTGGA...

Protein

Download Protein FASTA

470 aa · LXL04_012224|LXL04_012224|OH1004|PROTEIN

MHPLRRKVSLFSSYTAAMKQRKNNNLSVFVVVFSIFLFGFFMYNEDVKSIAEFPFSRPKFATHETSIQKSNVDGVVEISSRTTLVVESKTEDNQVIELPAPVAVAEEVEPEDDEEIEIPPEECDLYDGNWVFDDSTHPLYKEDECEFLTAQVTCMRNGRKDSMYQNWRWQPKNCNLPKFRAKLLLEKLRNKRLMFVGDSLNRNQWESMVCLAQSIIPPGRKSLNKTGSLSIFRIEDYNATVEFYWAPFLVESNSDDPNMH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_012224
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_012224
LocationChr03:8603118-8605571 (-)
DescriptionSimilar to ESK1: Protein ESKIMO 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g55990 Xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.
Arabidopsis ESK1 encodes a novel regulator of freezing tolerance.2007 · DOI: 10.1111/j.1365-313x.2006.02994.x
Metabolome and water status phenotyping of Arabidopsis under abiotic stress cues reveals new insight into ESK1 function.2009 · DOI: 10.1111/j.1365-3040.2008.01898.x
ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance.2008 · DOI: 10.1186/1471-2229-8-125
ESKIMO1 disruption in Arabidopsis alters vascular tissue and impairs water transport.2011 · DOI: 10.1371/journal.pone.0016645
The Arabidopsis DUF231 domain-containing protein ESK1 mediates 2-O- and 3-O-acetylation of xylosyl residues in xylan.2013 · DOI: 10.1093/pcp/pct070
Molecular Mechanism of Polysaccharide Acetylation by the Arabidopsis Xylan O-acetyltransferase XOAT1.2020 · DOI: 10.1105/tpc.20.00028
At2g40150 May act as a bridging protein that binds pectin and other cell wall polysaccharides. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0291800 Xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.
Biochemical characterization of rice xylan O-acetyltransferases.2018 · DOI: 10.1007/s00425-018-2882-1
Os05g0354400 Xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.
Biochemical characterization of rice xylan O-acetyltransferases.2018 · DOI: 10.1007/s00425-018-2882-1
Os01g0830700 Xylan acetyltransferase required for 2-O- and 3-O-monoacetylation of xylosyl residues in xylan.
Biochemical characterization of rice xylan O-acetyltransferases.2018 · DOI: 10.1007/s00425-018-2882-1
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_012224 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009409 response to cold Biological Process
GO:0045492 xylan biosynthetic process Biological Process
GO:0045893 positive regulation of DNA-templated transcription Biological Process
GO:0050826 response to freezing Biological Process
GO:0000139 Golgi membrane Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0016020 membrane Cellular Component
GO:0016413 O-acetyltransferase activity Molecular Function
GO:1990538 xylan O-acetyltransferase activity Molecular Function
KEGG gene cross-reference
ath:AT2G40150
ath:AT3G55990
dosa:Os03g0291800
dosa:Os05g0354400
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.615
Rank 1 · LXL04_012224 · OH-1004
Cell membrane0.096
Rank 2 · LXL04_012224 · OH-1004
Endoplasmic reticulum0.072
Rank 3 · LXL04_012224 · OH-1004
Extracellular0.049
Rank 4 · LXL04_012224 · OH-1004
Cytoplasm0.032
Rank 5 · LXL04_012224 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14416.12PMR5N121-175 aa
PF13839.13PC-Esterase176-464 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_012224PF14416.12PMR5N1211751.3e-2280.6
LXL04_012224PF13839.13PC-Esterase1764642e-94317.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LY46Arabidopsis thalianaXylan O-acetyltransferase 172.177%Swiss-Protstrong database homology
Q94K00Arabidopsis thalianaProtein trichome birefringence-like 2863.445%Swiss-Protstrong database homology
Q10MX2Oryza sativa subsp. japonicaXylan O-acetyltransferase 667.422%Swiss-Protstrong database homology
A0A0P0WL81Oryza sativa subsp. japonicaXylan O-acetyltransferase 566.857%Swiss-Protstrong database homology
Q8S237Oryza sativa subsp. japonicaXylan O-acetyltransferase 148.193%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser