LXL04_012211 | RubberDandelionOmics

Gene overview

LXL04_012211

Reference: OH-1004 Chr: Chr03 Coordinates: 8308933-8313106 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2621 bp · LXL04_012211|LXL04_012211|OH1004|cDNA

AAAACACAAATTCTATGGCGCCAGCTACAACTTCCTTACTCCACCACAACGGCATCTACTTCACATTCTCGGCGCGTGACTCTCACACTCTCTTCTTCAACTCCCACAACCACAAGTCTCTCCGTCCATCAAACAAGCTTCCTCTCAGTTCACTATCGTCAGTACCGTCGTCGCCGTCCGGCCGCCGTCGAACATTTGTATCCACCGTTCCGGTAGAGTATGTACCTCCAGCTCCAGATTTTGATTTCAATTCAGAACTA...

CDS

Download CDS FASTA

2607 bp · LXL04_012211|LXL04_012211|OH1004|CDS

ATGGCGCCAGCTACAACTTCCTTACTCCACCACAACGGCATCTACTTCACATTCTCGGCGCGTGACTCTCACACTCTCTTCTTCAACTCCCACAACCACAAGTCTCTCCGTCCATCAAACAAGCTTCCTCTCAGTTCACTATCGTCAGTACCGTCGTCGCCGTCCGGCCGCCGTCGAACATTTGTATCCACCGTTCCGGTAGAGTATGTACCTCCAGCTCCAGATTTTGATTTCAATTCAGAACTAGCGCGCCTCCGTAT...

Protein

Download Protein FASTA

868 aa · LXL04_012211|LXL04_012211|OH1004|PROTEIN

MAPATTSLLHHNGIYFTFSARDSHTLFFNSHNHKSLRPSNKLPLSSLSSVPSSPSGRRRTFVSTVPVEYVPPAPDFDFNSELARLRILRSKICASKSLRDKIRVVDSDSKVKRCFRRGHDKNGIARVLESFNLNEYELFLLKCIVAAGQEHVLGSGCDTDSDVDGEFVSARGSLKAALYTLVDMIEKWDGNDDREVYEKKVESVAFRSLLKTLREVEEFYDCIGGIIGYQLMVLELLSQSTHGEKNTNFQHINNSNSIGC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012211`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012211

Location Chr03:8308933-8313106 (+)

Description Similar to UGP3: UTP--glucose-1-phosphate uridylyltransferase 3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g56040`	Involved in the biosynthesis of sulfolipids in the chloroplast.	A chloroplastic UDP-glucose pyrophosphorylase from Arabidopsis is the committed enzyme for the first step of sulfolipid biosynthesis.2009 · DOI: 10.1105/tpc.108.063925
`At5g52560`	May participate in intine formation in developing pollen.	Characterization and expression of Arabidopsis UDP-sugar pyrophosphorylase.2006 · DOI: 10.1016/j.plaphy.2006.04.004

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YGP6`	May function as the terminal enzyme of the myo-inositol oxidation (MIO) pathway.	No verified direct reference in this release
`Os06g0701200`	May function as the terminal enzyme of the myo-inositol oxidation (MIO) pathway.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012211 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006011 UDP-alpha-D-glucose metabolic process Biological Process

GO:0006048 UDP-N-acetylglucosamine biosynthetic process Biological Process

GO:0009226 nucleotide-sugar biosynthetic process Biological Process

GO:0009555 pollen development Biological Process

GO:0033356 UDP-L-arabinose metabolic process Biological Process

GO:0046398 UDP-glucuronate metabolic process Biological Process

GO:0046506 sulfolipid biosynthetic process Biological Process

GO:0052573 UDP-D-galactose metabolic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0003977 UDP-N-acetylglucosamine diphosphorylase activity Molecular Function

KEGG gene cross-reference

ath:AT3G56040

ath:AT5G52560

cmo:103485690

dosa:Os06g0701200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.653

Rank 1 · LXL04_012211 · OH-1004

Cytoplasm0.162

Rank 2 · LXL04_012211 · OH-1004

Nucleus0.123

Rank 3 · LXL04_012211 · OH-1004

Cell membrane0.078

Rank 4 · LXL04_012211 · OH-1004

Peroxisome0.061

Rank 5 · LXL04_012211 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25441.2Hexapep_UGP3_C704-862 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012211	`PF25441.2`	Hexapep_UGP3_C	704	862	1.5e-70	237.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IY62`	Arabidopsis thaliana	UTP--glucose-1-phosphate uridylyltransferase 3, chloroplastic	64.756%	Swiss-Prot	strong database homology
`Q9C5I1`	Arabidopsis thaliana	UDP-sugar pyrophosphorylase	22.819%	Swiss-Prot	weak database homology
`A2YGP6`	Oryza sativa subsp. indica	UDP-sugar pyrophosphorylase	22.053%	Swiss-Prot	weak database homology
`Q5Z8Y4`	Oryza sativa subsp. japonica	UDP-sugar pyrophosphorylase	21.863%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card