Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1353 bp · LXL04_012203|LXL04_012203|OH1004|cDNA
ATGGAGAAGCTGGTGGAAGTCTCGGACCAGGTGGTATGCATCGACTTCGTACTCGGAACCAAATGCAGAGCCACCGTCCGCCTCAGATCTCTCAGCGCAACCACCGCAATCGCCTTCAAAATCCAAACCTCATCTCCTCACAAGTTCCTGGTCAATCCACCGAGTGGACTCATCTCTCCTCTTTCTCAATCCACATTTCAAATAATCCTCAGACCGCAACCGAAAATTCCTTCTACTTTCCCCCGCTCCGCCTCCGACAA...
1353 bp · LXL04_012203|LXL04_012203|OH1004|CDS
ATGGAGAAGCTGGTGGAAGTCTCGGACCAGGTGGTATGCATCGACTTCGTACTCGGAACCAAATGCAGAGCCACCGTCCGCCTCAGATCTCTCAGCGCAACCACCGCAATCGCCTTCAAAATCCAAACCTCATCTCCTCACAAGTTCCTGGTCAATCCACCGAGTGGACTCATCTCTCCTCTTTCTCAATCCACATTTCAAATAATCCTCAGACCGCAACCGAAAATTCCTTCTACTTTCCCCCGCTCCGCCTCCGACAA...
Protein
Download Protein FASTA450 aa · LXL04_012203|LXL04_012203|OH1004|PROTEIN
MEKLVEVSDQVVCIDFVLGTKCRATVRLRSLSATTAIAFKIQTSSPHKFLVNPPSGLISPLSQSTFQIILRPQPKIPSTFPRSASDKFLLRTCLVGSAGPTNPDTITSWTHDIKLKVAFVGPFLLRHAVNSGDCDAVRSMVKFQKTILSELSTREAESLHRVATRLDNAVEMVSLLLETGLKIGSTTRILEDVEESRWTEKGWSELHVAVAYDRADEVSRLIKMRKPGALDCQDREGKTPLYLAASKGYERCVKLLAGAG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_012203 |
|---|---|
| TK1151 ID | TkA02G581930 |
| OH-1004 ID | LXL04_012203 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_012203 |
|---|---|
| Location | Chr03:8218643-8220104 (-) |
| Description | Similar to VPY: Protein VAPYRIN |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000281 mitotic cytokinesis Biological Process GO:0002237 response to molecule of bacterial origin Biological Process GO:0007009 plasma membrane organization Biological Process GO:0007165 signal transduction Biological Process GO:0007528 neuromuscular junction development Biological Process GO:0009609 response to symbiotic bacterium Biological Process GO:0009610 response to symbiotic fungus Biological Process GO:0009877 nodulation Biological Process GO:0010247 detection of phosphate ion Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0010650 positive regulation of cell communication by electrical coupling Biological Process GO:0010765 positive regulation of sodium ion transport Biological Process |
| KEGG gene cross-reference | hsa:288 mtr:11415982 mtr:25495843 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00635.33Motile_Sperm32-108 aaPF12796.14Ank_2160-266 aaPF13637.13Ank_4206-256 aaPF13857.13Ank_5227-274 aaPF00023.37Ank237-266 aaPF13637.13Ank_4244-289 aaPF12796.14Ank_2261-323 aaPF00023.37Ank269-299 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_012203 | PF00635.33 | Motile_Sperm | 32 | 108 | 1.5e-11 | 44.8 |
| LXL04_012203 | PF12796.14 | Ank_2 | 160 | 266 | 2.6e-43 | 147.2 |
| LXL04_012203 | PF13637.13 | Ank_4 | 206 | 256 | 6.6e-37 | 125.4 |
| LXL04_012203 | PF13857.13 | Ank_5 | 227 | 274 | 2.2e-31 | 108.3 |
| LXL04_012203 | PF00023.37 | Ank | 237 | 266 | 1.8e-42 | 141.6 |
| LXL04_012203 | PF13637.13 | Ank_4 | 244 | 289 | 6.6e-37 | 125.4 |
| LXL04_012203 | PF12796.14 | Ank_2 | 261 | 323 | 2.6e-43 | 147.2 |
| LXL04_012203 | PF00023.37 | Ank | 269 | 299 | 1.8e-42 | 141.6 |
| LXL04_012203 | PF24521.3 | Ank_KRIT1 | 327 | 432 | 2.9e-11 | 44.0 |
| LXL04_012203 | PF12796.14 | Ank_2 | 331 | 420 | 2.6e-43 | 147.2 |
| LXL04_012203 | PF13637.13 | Ank_4 | 331 | 374 | 6.6e-37 | 125.4 |
| LXL04_012203 | PF13857.13 | Ank_5 | 344 | 398 | 2.2e-31 | 108.3 |
| LXL04_012203 | PF00023.37 | Ank | 357 | 388 | 1.8e-42 | 141.6 |
| LXL04_012203 | PF13637.13 | Ank_4 | 362 | 411 | 6.6e-37 | 125.4 |
| LXL04_012203 | PF13857.13 | Ank_5 | 377 | 431 | 2.2e-31 | 108.3 |
| LXL04_012203 | PF13606.13 | Ank_3 | 390 | 419 | 1.5e-27 | 92.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.