LXL04_012121 | RubberDandelionOmics

Gene overview

LXL04_012121

Reference: OH-1004 Chr: Chr03 Coordinates: 6886819-6889535 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1740 bp · LXL04_012121|LXL04_012121|OH1004|cDNA

ATGGCGTCTGTTTCTGTGTTCAGAGGCTTTGTCCATGGCCATCGCGTCTCTCTTTTACCCCACCAGTCGCAGGGTTGCTTAACTCTGATTAGAACTTCTTTCCTCCTCTGTTCAAATCGATTGCATCAAATGCGTCATTTGGGGAAGCTCAACAGTTTTCACTTGGGCGAGTTACCGGTTACAAGCATATGGATTGGCTCAAAGAAGCTTGAGTACCAATCTAATGGCTTGAGGCTCTATGCAAGATATTCAGAGTCACA...

CDS

Download CDS FASTA

1740 bp · LXL04_012121|LXL04_012121|OH1004|CDS

ATGGCGTCTGTTTCTGTGTTCAGAGGCTTTGTCCATGGCCATCGCGTCTCTCTTTTACCCCACCAGTCGCAGGGTTGCTTAACTCTGATTAGAACTTCTTTCCTCCTCTGTTCAAATCGATTGCATCAAATGCGTCATTTGGGGAAGCTCAACAGTTTTCACTTGGGCGAGTTACCGGTTACAAGCATATGGATTGGCTCAAAGAAGCTTGAGTACCAATCTAATGGCTTGAGGCTCTATGCAAGATATTCAGAGTCACA...

Protein

Download Protein FASTA

579 aa · LXL04_012121|LXL04_012121|OH1004|PROTEIN

MASVSVFRGFVHGHRVSLLPHQSQGCLTLIRTSFLLCSNRLHQMRHLGKLNSFHLGELPVTSIWIGSKKLEYQSNGLRLYARYSESQSARTQDLFTSRLQDSIEKLPKLVEDIVQTSINTGPRGALRLAQGVQAVIGVGSEWLTELSQSRTSPSELPSQLQLGLLSPLYLRKLFERLGATYIKLGQFIASAPTLFPQEYVQEFQYCFDRAPVVPFEEIKRILREDLPGPIDTIYDFIDPTPLASASIAQVHAARLKGSQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012121`
TK1151 ID	TkA02G586430
OH-1004 ID	LXL04_012121
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012121

Location Chr03:6886819-6889535 (-)

Description Similar to At5g05200: Uncharacterized aarF domain-containing protein kinase At5g05200, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g05200`	Uncharacterized aarF domain-containing protein kinase At5g05200, chloroplastic.	No verified direct reference in this release
`At5g64940`	May participate in responses to oxidative stress, high light and heavy metals.	Loss of the Atypical Kinases ABC1K7 and ABC1K8 Changes the Lipid Composition of the Chloroplast Membrane.2015 · DOI: 10.1093/pcp/pcv046

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012121 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0010150 leaf senescence Biological Process

GO:0010795 regulation of ubiquinone biosynthetic process Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0046467 membrane lipid biosynthetic process Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:1901031 regulation of response to reactive oxygen species Biological Process

GO:1990641 response to iron ion starvation Biological Process

KEGG gene cross-reference

aha:AHA_0086

ath:AT5G05200

ath:AT5G64940

mtc:MT0675

mtu:Rv0647c

mtv:RVBD_0647c

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.986

Rank 1 · LXL04_012121 · OH-1004

Mitochondrion0.025

Rank 2 · LXL04_012121 · OH-1004

Cytoplasm0.016

Rank 3 · LXL04_012121 · OH-1004

Nucleus0.013

Rank 4 · LXL04_012121 · OH-1004

Peroxisome0.012

Rank 5 · LXL04_012121 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03109.23ABC1208-453 aa

PF27536.1UbiB_helical513-558 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012121	`PF03109.23`	ABC1	208	453	1.3e-58	198.8
LXL04_012121	`PF27536.1`	UbiB_helical	513	558	9.6e-06	25.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ASX5`	Arabidopsis thaliana	Uncharacterized aarF domain-containing protein kinase At5g05200, chloroplastic	77.925%	Swiss-Prot	strong database homology
`Q93Y08`	Arabidopsis thaliana	Protein ACTIVITY OF BC1 COMPLEX KINASE 8, chloroplastic	33.446%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card