LXL04_012098 | RubberDandelionOmics

Gene overview

LXL04_012098

Reference: OH-1004 Chr: Chr03 Coordinates: 6315426-6316456 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · LXL04_012098|LXL04_012098|OH1004|cDNA

ATGGCTTCCATTGTCATCAATGCTGCAATGCACAGAGCTTGCAGCTCTCCTCACCTAACCACTAAAGATGTGCCATCTCAGCTAGGAACCACCCGCTCCTTAGGAACCAAACAGGCAGCTCCATTTGTATCTCTCAATGTCGAAGGCCAAAATGCTCCAAACGCACCTCAAGAACAAAAACAGAGCAACAATGGAGTCGAGAATGGTGATATGACAGAAACTTCTATCAACAAATTCACTGATGAGCGATGGAAACATGG...

CDS

Download CDS FASTA

720 bp · LXL04_012098|LXL04_012098|OH1004|CDS

ATGGCTTCCATTGTCATCAATGCTGCAATGCACAGAGCTTGCAGCTCTCCTCACCTAACCACTAAAGATGTGCCATCTCAGCTAGGAACCACCCGCTCCTTAGGAACCAAACAGGCAGCTCCATTTGTATCTCTCAATGTCGAAGGCCAAAATGCTCCAAACGCACCTCAAGAACAAAAACAGAGCAACAATGGAGTCGAGAATGGTGATATGACAGAAACTTCTATCAACAAATTCACTGATGAGCGATGGAAACATGG...

Protein

Download Protein FASTA

239 aa · LXL04_012098|LXL04_012098|OH1004|PROTEIN

MASIVINAAMHRACSSPHLTTKDVPSQLGTTRSLGTKQAAPFVSLNVEGQNAPNAPQEQKQSNNGVENGDMTETSINKFTDERWKHGTWDLNMFVKSGKMDWDALIVAEARRRKSLELFPEMATNTDPVVFRSSIIPWWAWITHSHPPEAELLNGRAAMVGFFMAYFVDVLKGLDVVGQSGNFICKIGLFATVIGVVLFRQTKSIQDLKNLADEATFYDKQWQASWQDQNSGGGASGKR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012098`
TK1151 ID	TkA02G587610
OH-1004 ID	LXL04_012098
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	77.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012098

Location Chr03:6315426-6316456 (-)

Description Similar to LIL3.1: Light-harvesting complex-like protein 3 isotype 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17600`	Light-harvesting-like protein required for biosynthesis of phytylated chlorophylls and alpha-tocopherol in green seedlings.	No verified direct reference in this release
`At5g47110`	Light-harvesting-like protein required for biosynthesis of phytylated chlorophylls and alpha-tocopherol in green seedlings.	Lil3 dimerization and chlorophyll binding in Arabidopsis thaliana.2015 · DOI: 10.1016/j.febslet.2015.08.023

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012098 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0015979 photosynthesis Biological Process

GO:1902326 positive regulation of chlorophyll biosynthetic process Biological Process

GO:1904964 positive regulation of phytol biosynthetic process Biological Process

GO:1904966 positive regulation of vitamin E biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009503 thylakoid light-harvesting complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009523 photosystem II Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT4G17600

ath:AT5G47110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.966

Rank 1 · LXL04_012098 · OH-1004

Mitochondrion0.036

Rank 2 · LXL04_012098 · OH-1004

Nucleus0.022

Rank 3 · LXL04_012098 · OH-1004

Cytoplasm0.017

Rank 4 · LXL04_012098 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_012098 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30879.1LIL3_78-155 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012098	`PF30879.1`	LIL3_	78	155	5e-37	126.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SYX1`	Arabidopsis thaliana	Light-harvesting complex-like protein 3 isotype 1, chloroplastic	54.404%	Swiss-Prot	strong database homology
`Q6NKS4`	Arabidopsis thaliana	Light-harvesting complex-like protein 3 isotype 2, chloroplastic	53.933%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card