LXL04_012071 | RubberDandelionOmics

Gene overview

LXL04_012071

Reference: OH-1004 Chr: Chr03 Coordinates: 5885500-5895286 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3309 bp · LXL04_012071|LXL04_012071|OH1004|cDNA

ATGAAAATGGCGGCCGGCTTGCTTCTCCTTCTCATCGCTCTTCTCTCCACGGTAACAGGAGATGAGGCTAAGAGTTCAAGTAATTTTCCATTAGTAGTAAGCACCTGGCCCTTCTTAGAAGCTGTGAGAGCTGGATGGAGGGCTATCAATGGTGGATTATCTCCCATTGATGCAGTTGTTGAAGGTTGTTCAGCTTGTGAGATACTTAGATGTGATGGTACAGTTGGACCTGGTGGGAGTCCAGATGAGAACAGTGAAAC...

CDS

Download CDS FASTA

3309 bp · LXL04_012071|LXL04_012071|OH1004|CDS

ATGAAAATGGCGGCCGGCTTGCTTCTCCTTCTCATCGCTCTTCTCTCCACGGTAACAGGAGATGAGGCTAAGAGTTCAAGTAATTTTCCATTAGTAGTAAGCACCTGGCCCTTCTTAGAAGCTGTGAGAGCTGGATGGAGGGCTATCAATGGTGGATTATCTCCCATTGATGCAGTTGTTGAAGGTTGTTCAGCTTGTGAGATACTTAGATGTGATGGTACAGTTGGACCTGGTGGGAGTCCAGATGAGAACAGTGAAAC...

Protein

Download Protein FASTA

1102 aa · LXL04_012071|LXL04_012071|OH1004|PROTEIN

MKMAAGLLLLLIALLSTVTGDEAKSSSNFPLVVSTWPFLEAVRAGWRAINGGLSPIDAVVEGCSACEILRCDGTVGPGGSPDENSETTMDALIMNGATMEVGAVAAMRYVKDGIKAARLVMLHTEHTMLAGDQASAFAISMGLQGPSNLSSIESMEKWIKWKENQCQPNFRKNVVPTDSCGPYYRKKDVNLDDKTCLVEDVAENIRMKSSYVDFHNHDTISMAIFDKSGHIAVGTSTNGASFKIPGRVGDGPIAGSSAYA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012071`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012071

Location Chr03:5885500-5895286 (+)

Description Similar to CERK: Ceramide kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51290`	Catalyzes specifically the phosphorylation of ceramide to form ceramide 1-phosphate.	Ceramides modulate programmed cell death in plants.2003 · DOI: 10.1101/gad.1140503
`At5g61540`	Acts in asparagine catabolism but also in the final steps of protein degradation via hydrolysis of a range of isoaspartyl dipeptides.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0656200`	Catalyzes specifically the phosphorylation of ceramide to form ceramide 1-phosphate.	A conserved cysteine motif is critical for rice ceramide kinase activity and function.2011 · DOI: 10.1371/journal.pone.0018079

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012071 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006517 protein deglycosylation Biological Process

GO:0006672 ceramide metabolic process Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009651 response to salt stress Biological Process

GO:0012501 programmed cell death Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005764 lysosome Cellular Component

KEGG gene cross-reference

ath:AT5G51290

ath:AT5G61540

dosa:Os02g0656200

dya:Dyak_GE19290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.278

Rank 1 · LXL04_012071 · OH-1004

Golgi apparatus0.240

Rank 2 · LXL04_012071 · OH-1004

Cell membrane0.184

Rank 3 · LXL04_012071 · OH-1004

Lysosome / Vacuole0.166

Rank 4 · LXL04_012071 · OH-1004

Cytoplasm0.160

Rank 5 · LXL04_012071 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01112.24Asparaginase_224-331 aa

PF00781.30DAGK_cat518-597 aa

PF19280.5CERK_C729-944 aa

PF04511.21DER1949-1073 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012071	`PF01112.24`	Asparaginase_2	24	331	1.2e-71	242.1
LXL04_012071	`PF00781.30`	DAGK_cat	518	597	3.7e-17	62.8
LXL04_012071	`PF19280.5`	CERK_C	729	944	5.5e-18	66.0
LXL04_012071	`PF04511.21`	DER1	949	1073	1.3e-21	78.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6USK2`	Arabidopsis thaliana	Ceramide kinase	56.048%	Swiss-Prot	moderate database homology
`Q56W64`	Arabidopsis thaliana	Probable isoaspartyl peptidase/L-asparaginase 3	72.156%	Swiss-Prot	weak database homology
`C0LT23`	Oryza sativa subsp. japonica	Ceramide kinase	49.667%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card