LXL04_011989 | RubberDandelionOmics

Gene overview

LXL04_011989

Reference: OH-1004 Chr: Chr03 Coordinates: 4189861-4191843 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1983 bp · LXL04_011989|LXL04_011989|OH1004|cDNA

ATGCCATCTCGACTACCTCCGTCTCCGTCGCCATCCTCACAGCCACCGCCACCTGACCAGCACCATATCCGCCTTGGTCCTCCACTAGCGGTTGCTTTCTCTTTCCTCATAGCCCTAACCTTCTGCTTCCGCAAGTTCACAACACGCAAGCGCACCGCCCCTTCCGACTCTAAACCTCCTCACAAGTTTTCCTATACCGCGCTCAGCCGCGCTACCTCTTCCTTTTCCGTCTCCAACCGCCTTGGTCAAGGCGGTTTCGG...

CDS

Download CDS FASTA

1983 bp · LXL04_011989|LXL04_011989|OH1004|CDS

ATGCCATCTCGACTACCTCCGTCTCCGTCGCCATCCTCACAGCCACCGCCACCTGACCAGCACCATATCCGCCTTGGTCCTCCACTAGCGGTTGCTTTCTCTTTCCTCATAGCCCTAACCTTCTGCTTCCGCAAGTTCACAACACGCAAGCGCACCGCCCCTTCCGACTCTAAACCTCCTCACAAGTTTTCCTATACCGCGCTCAGCCGCGCTACCTCTTCCTTTTCCGTCTCCAACCGCCTTGGTCAAGGCGGTTTCGG...

Protein

Download Protein FASTA

660 aa · LXL04_011989|LXL04_011989|OH1004|PROTEIN

MPSRLPPSPSPSSQPPPPDQHHIRLGPPLAVAFSFLIALTFCFRKFTTRKRTAPSDSKPPHKFSYTALSRATSSFSVSNRLGQGGFGSVYRGTLINNQDVAVKVMDAGSLQGEREFQNELFFAGKIDSDRITAVVGFSSDRRRRRMVLVYELMTNGSLQDCLLHRKSPELKEWKKRLSVAIDVAKGIEYLHHYCDPPIIHGDIKPSNILLDHNFNAKIGDFGLARLKPEDECRIDLNNKIEEGKNIGSSIIEDSGSVFEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011989`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011989

Location Chr03:4189861-4191843 (-)

Description Similar to At4g25390: Receptor-like serine/threonine-protein kinase At4g25390

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25390`	Receptor-like serine/threonine-protein kinase At4g25390.	No verified direct reference in this release
`At2g45590`	Receptor-like serine/threonine-protein kinase At2g45590.	No verified direct reference in this release
`At1g80870`	Putative receptor-like protein kinase At1g80870.	No verified direct reference in this release
`At1g49270`	Proline-rich receptor-like protein kinase PERK7.	No verified direct reference in this release
`At3g24540`	Proline-rich receptor-like protein kinase PERK3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011989 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G49270

ath:AT1G80870

ath:AT2G45590

ath:AT4G25390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.659

Rank 1 · LXL04_011989 · OH-1004

Nucleus0.247

Rank 2 · LXL04_011989 · OH-1004

Cytoplasm0.201

Rank 3 · LXL04_011989 · OH-1004

Endoplasmic reticulum0.055

Rank 4 · LXL04_011989 · OH-1004

Plastid0.030

Rank 5 · LXL04_011989 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase76-228 aa

PF07714.24PK_Tyr_Ser-Thr77-231 aa

PF00069.32Pkinase517-630 aa

PF07714.24PK_Tyr_Ser-Thr518-631 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011989	`PF00069.32`	Pkinase	76	228	4.1e-36	125.5
LXL04_011989	`PF07714.24`	PK_Tyr_Ser-Thr	77	231	1.1e-35	123.9
LXL04_011989	`PF00069.32`	Pkinase	517	630	4.1e-36	125.5
LXL04_011989	`PF07714.24`	PK_Tyr_Ser-Thr	518	631	1.1e-35	123.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STJ8`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase At4g25390	51.664%	Swiss-Prot	strong database homology
`O64639`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase At2g45590	49.160%	Swiss-Prot	moderate database homology
`Q9SAH3`	Arabidopsis thaliana	Putative receptor-like protein kinase At1g80870	32.836%	Swiss-Prot	moderate database homology
`Q9XI96`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK7	47.093%	Swiss-Prot	weak database homology
`Q1PEM5`	Arabidopsis thaliana	Proline-rich receptor-like protein kinase PERK3	38.057%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card