LXL04_011890 | RubberDandelionOmics

Gene overview

LXL04_011890

Reference: OH-1004 Chr: Chr03 Coordinates: 2347051-2348349 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

693 bp · LXL04_011890|LXL04_011890|OH1004|cDNA

ATGGGGTTGGAAGTTAATGCCGTGTACCTCTCTTATGTGGTGCACGTTCTGGCCGTCGCCGGATCGGTGATGGTTCTGGTTTGGAACATCCACTTCAGAGGCGGATTAGCTTGGGAATCTACTAACAAGAATCTCATCTTCAACGTTCATCCTGTTCTGATGCTAATTGGTTTGATTATCATGGGCGGTGAAGCCATCGTAAGCTACAAAGCTCTTCCGTTCAAAAAGGCTGAAAAGAAGCTCATACATCTTATCCTTCA...

CDS

Download CDS FASTA

693 bp · LXL04_011890|LXL04_011890|OH1004|CDS

ATGGGGTTGGAAGTTAATGCCGTGTACCTCTCTTATGTGGTGCACGTTCTGGCCGTCGCCGGATCGGTGATGGTTCTGGTTTGGAACATCCACTTCAGAGGCGGATTAGCTTGGGAATCTACTAACAAGAATCTCATCTTCAACGTTCATCCTGTTCTGATGCTAATTGGTTTGATTATCATGGGCGGTGAAGCCATCGTAAGCTACAAAGCTCTTCCGTTCAAAAAGGCTGAAAAGAAGCTCATACATCTTATCCTTCA...

Protein

Download Protein FASTA

230 aa · LXL04_011890|LXL04_011890|OH1004|PROTEIN

MGLEVNAVYLSYVVHVLAVAGSVMVLVWNIHFRGGLAWESTNKNLIFNVHPVLMLIGLIIMGGEAIVSYKALPFKKAEKKLIHLILHAIALVLGIIGIYMAFKNHNESGIANLYSLHSWLGIGIIVLYGVQWVYGFLVFFYPGGTGDLRKESLPWHVLFGMFVYILAVANSALGFLEKLTFLESSGIAKYGSEAFLVNFTAIVAVLYGTFVLLTALSRAPAEDNHSYSAI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011890`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011890

Location Chr03:2347051-2348349 (-)

Description Similar to CYB561A: Transmembrane ascorbate ferrireductase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g25570`	Two-heme-containing cytochrome.	Localization of an ascorbate-reducible cytochrome b561 in the plant tonoplast.2004 · DOI: 10.1104/pp.103.032359

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0642300`	Two-heme-containing cytochrome.	No verified direct reference in this release
`Os04g0533500`	Two-heme-containing cytochrome.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011890 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0009055 electron transfer activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0019904 protein domain specific binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0140571 transmembrane ascorbate ferrireductase activity Molecular Function

KEGG gene cross-reference

ath:AT4G25570

dosa:Os02g0642300

dosa:Os04g0533500

zma:100273009

zma:100384594

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.297

Rank 1 · LXL04_011890 · OH-1004

Cytoplasm0.287

Rank 2 · LXL04_011890 · OH-1004

Lysosome / Vacuole0.282

Rank 3 · LXL04_011890 · OH-1004

Cell membrane0.219

Rank 4 · LXL04_011890 · OH-1004

Endoplasmic reticulum0.152

Rank 5 · LXL04_011890 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03188.22Cytochrom_B56149-181 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011890	`PF03188.22`	Cytochrom_B561	49	181	1.4e-46	158.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L856`	Arabidopsis thaliana	Transmembrane ascorbate ferrireductase 1	69.767%	Swiss-Prot	strong database homology
`A3A9H6`	Oryza sativa subsp. japonica	Probable ascorbate-specific transmembrane electron transporter 1	67.532%	Swiss-Prot	strong database homology
`Q7XMK3`	Oryza sativa subsp. japonica	Probable ascorbate-specific transmembrane electron transporter 2	64.348%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card