LXL04_011852 | RubberDandelionOmics

Gene overview

LXL04_011852

Reference: OH-1004 Chr: Chr03 Coordinates: 1552370-1555478 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1962 bp · LXL04_011852|LXL04_011852|OH1004|cDNA

ATGGCGGAACAATATTTCACTCCTCCAGCTACAGAAAGGTTCTATAGCTTTTGGAGTTTTCGacaatatcaaaagatgaagaacaaaaacatttttgtattCTCTGCAATTTTCTTGTTCGGAGCAACTGTATCCCTGGTTGCCGGAGAGCCATTGGAAGATAAGCAGGTTTTAATTAATTTCATTCAAAGCATCACACACAGTCGCGCAATCAACTGGGATATGGGTTCTTCAGCTTGTGCTAACTGGACCGGGATAAC...

CDS

Download CDS FASTA

1962 bp · LXL04_011852|LXL04_011852|OH1004|CDS

ATGGCGGAACAATATTTCACTCCTCCAGCTACAGAAAGGTTCTATAGCTTTTGGAGTTTTCGACAATATCAAAAGATGAAGAACAAAAACATTTTTGTATTCTCTGCAATTTTCTTGTTCGGAGCAACTGTATCCCTGGTTGCCGGAGAGCCATTGGAAGATAAGCAGGTTTTAATTAATTTCATTCAAAGCATCACACACAGTCGCGCAATCAACTGGGATATGGGTTCTTCAGCTTGTGCTAACTGGACCGGGATAAC...

Protein

Download Protein FASTA

653 aa · LXL04_011852|LXL04_011852|OH1004|PROTEIN

MAEQYFTPPATERFYSFWSFRQYQKMKNKNIFVFSAIFLFGATVSLVAGEPLEDKQVLINFIQSITHSRAINWDMGSSACANWTGITCNHDESRIIALRLPAFSLQGPIPPNTLGQLSDLQILSLRSNGLTGPLPPDFANLRNLTALYLQSNGFYGPLPMNFSKWNNLSILDLSNNGFNGSIPSSISNLTHLTALNLANNSFSGEIPNVSIPSLQALNLSNNNLTGPVPQSLDRFPSSSFAGNNISPLTSPPPVPSPAAQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011852`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011852

Location Chr03:1552370-1555478 (-)

Description Similar to At4g23740: Probable inactive receptor kinase At4g23740

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23740`	Probable inactive receptor kinase At4g23740.	No verified direct reference in this release
`At1g64210`	Putative inactive receptor-like protein kinase At1g64210.	No verified direct reference in this release
`At5g53320`	Probable inactive receptor kinase At5g53320.	No verified direct reference in this release
`At5g24100`	Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At5g24100.	No verified direct reference in this release
`At2g26730`	Probable inactive receptor kinase At2g26730.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011852 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT1G64210

ath:AT2G26730

ath:AT4G23740

ath:AT5G24100

ath:AT5G53320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.876

Rank 1 · LXL04_011852 · OH-1004

Cytoplasm0.076

Rank 2 · LXL04_011852 · OH-1004

Endoplasmic reticulum0.067

Rank 3 · LXL04_011852 · OH-1004

Nucleus0.059

Rank 4 · LXL04_011852 · OH-1004

Lysosome / Vacuole0.019

Rank 5 · LXL04_011852 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_253-89 aa

PF13855.13LRR_8109-153 aa

PF13855.13LRR_8162-201 aa

PF00069.32Pkinase348-613 aa

PF07714.24PK_Tyr_Ser-Thr349-613 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011852	`PF08263.18`	LRRNT_2	53	89	9.6e-08	32.9
LXL04_011852	`PF13855.13`	LRR_8	109	153	1.1e-13	51.5
LXL04_011852	`PF13855.13`	LRR_8	162	201	1.1e-13	51.5
LXL04_011852	`PF00069.32`	Pkinase	348	613	5e-30	105.5
LXL04_011852	`PF07714.24`	PK_Tyr_Ser-Thr	349	613	1.1e-34	120.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SUQ3`	Arabidopsis thaliana	Probable inactive receptor kinase At4g23740	57.730%	Swiss-Prot	strong database homology
`Q9SH71`	Arabidopsis thaliana	Putative inactive receptor-like protein kinase At1g64210	51.586%	Swiss-Prot	strong database homology
`Q9FK10`	Arabidopsis thaliana	Probable inactive receptor kinase At5g53320	53.413%	Swiss-Prot	strong database homology
`Q9FL63`	Arabidopsis thaliana	Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At5g24100	48.052%	Swiss-Prot	moderate database homology
`O48788`	Arabidopsis thaliana	Probable inactive receptor kinase At2g26730	51.752%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card