LXL04_011833 | RubberDandelionOmics

Gene overview

LXL04_011833

Reference: OH-1004 Chr: Chr03 Coordinates: 1248237-1249884 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1035 bp · LXL04_011833|LXL04_011833|OH1004|cDNA

ATGATATGCAGCAGTTACCTGAGGACATTGATTGTGCAAGTTGGGCATATTGGGAAACCTGTGGAAGGGTTAGGGTTGGTGCAGTTTGCAAAATCGAAGACGATTCCTCCAACAATAACATTATTATCCCCTGATCAAAAGCTTTCAAAATATACAAAAAGGATGATGGCTACCGGGACCCGGGGAACGATCGTCGATGCTCTGACAGAAAGGGATGGTGAAGGTGCATATTCTAGTGGAGGTTGGAAGAGTGAAGATGG...

CDS

Download CDS FASTA

1035 bp · LXL04_011833|LXL04_011833|OH1004|CDS

ATGATATGCAGCAGTTACCTGAGGACATTGATTGTGCAAGTTGGGCATATTGGGAAACCTGTGGAAGGGTTAGGGTTGGTGCAGTTTGCAAAATCGAAGACGATTCCTCCAACAATAACATTATTATCCCCTGATCAAAAGCTTTCAAAATATACAAAAAGGATGATGGCTACCGGGACCCGGGGAACGATCGTCGATGCTCTGACAGAAAGGGATGGTGAAGGTGCATATTCTAGTGGAGGTTGGAAGAGTGAAGATGG...

Protein

Download Protein FASTA

344 aa · LXL04_011833|LXL04_011833|OH1004|PROTEIN

MICSSYLRTLIVQVGHIGKPVEGLGLVQFAKSKTIPPTITLLSPDQKLSKYTKRMMATGTRGTIVDALTERDGEGAYSSGGWKSEDGKLRCGYSSFRGKRPSMEDCYDIKTCKIDGKMVCLFGIFDGHGGSRASQYLKENLFKNLMKHPEFITNTKVAISETYQQTDKDFLESEKDNFRDDGSTASTAVLVGNHLYVANVGDSRTVISNEGKAVALSEDHKPNRSDERMRIESAGGVVMWAGTWRVGGVLAMSRAFGNRM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011833`
TK1151 ID	TkA02G609480
OH-1004 ID	LXL04_011833
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011833

Location Chr03:1248237-1249884 (+)

Description Similar to At5g53140: Probable protein phosphatase 2C 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53140`	Probable protein phosphatase 2C 76.	No verified direct reference in this release
`At4g31750`	Protein phosphatase that modulates defense response to pathogenic bacteria, conferring resistance and promoting salicylic acid (SA) accumulation.	Arabidopsis proteins important for modulating defense responses to Pseudomonas syringae that secrete HopW1-1.2008 · DOI: 10.1111/j.1365-313x.2008.03439.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0587100`	Probable protein phosphatase 2C 52.	No verified direct reference in this release
`Os02g0255100`	Probable protein phosphatase that may play a role as a mitochondrial signal transduction mediator in pollen germination.	DCW11, down-regulated gene 11 in CW-type cytoplasmic male sterile rice, encoding mitochondrial protein phosphatase 2c is related to cytoplasmic male sterility.2008 · DOI: 10.1093/pcp/pcn036
`Os01g0618200`	Probable protein phosphatase 2C 7.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011833 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0007165 signal transduction Biological Process

GO:0009846 pollen germination Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G31750

ath:AT5G53140

dosa:Os02g0255100

dosa:Os05g0587100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.766

Rank 1 · LXL04_011833 · OH-1004

Plastid0.153

Rank 2 · LXL04_011833 · OH-1004

Cytoplasm0.120

Rank 3 · LXL04_011833 · OH-1004

Nucleus0.095

Rank 4 · LXL04_011833 · OH-1004

Cell membrane0.038

Rank 5 · LXL04_011833 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C92-329 aa

PF13672.12PP2C_2139-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011833	`PF00481.27`	PP2C	92	329	3e-63	214.6
LXL04_011833	`PF13672.12`	PP2C_2	139	300	7.6e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AT1`	Arabidopsis thaliana	Probable protein phosphatase 2C 76	65.029%	Swiss-Prot	strong database homology
`Q8RXV3`	Arabidopsis thaliana	Probable protein phosphatase 2C 59	61.479%	Swiss-Prot	strong database homology
`Q6L5C4`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 52	81.298%	Swiss-Prot	strong database homology
`Q6EN45`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C member 13, mitochondrial	76.892%	Swiss-Prot	strong database homology
`Q0JL75`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 7	69.288%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card