LXL04_011806 | RubberDandelionOmics

Gene overview

LXL04_011806

Reference: OH-1004 Chr: Chr03 Coordinates: 679290-684441 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1886 bp · LXL04_011806|LXL04_011806|OH1004|cDNA

ATGGTAAGAAGTAAGAAGAAGACCATGGAGGACACCCGCACTTTTAACATGGAACCCTCTGCCTGTAATGCCAATGGCAAGCCTCTTGACATCCACTTGGTCTCGTCAACCGACTCTCCCGAGTTCGCTCGTTTGAATTGGGCACTGACTCACTCCTCCATCATCGGACTCGACGCCGAATGGAAGCCTGTCCGAGCTCACCAACCCAACTTCCCCACCGTTTTGCTTCTCCAAATTGCTTGTCGACTCAATTCCGACGA...

CDS

Download CDS FASTA

1848 bp · LXL04_011806|LXL04_011806|OH1004|CDS

ATGGTAAGAAGTAAGAAGAAGACCATGGAGGACACCCGCACTTTTAACATGGAACCCTCTGCCTGTAATGCCAATGGCAAGCCTCTTGACATCCACTTGGTCTCGTCAACCGACTCTCCCGAGTTCGCTCGTTTGAATTGGGCACTGACTCACTCCTCCATCATCGGACTCGACGCCGAATGGAAGCCTGTCCGAGCTCACCAACCCAACTTCCCCACCGTTTTGCTTCTCCAAATTGCTTGTCGACTCAATTCCGACGA...

Protein

Download Protein FASTA

615 aa · LXL04_011806|LXL04_011806|OH1004|PROTEIN

MVRSKKKTMEDTRTFNMEPSACNANGKPLDIHLVSSTDSPEFARLNWALTHSSIIGLDAEWKPVRAHQPNFPTVLLLQIACRLNSDESTQEHDKSIVFLLDLSEILLPSIYQLLRDVFVSPDILKLGFRFKQDLLYLSSTFTSQGCDSGFHRVEPFLDIATIYSHLHPKQSRRKTKGTKSLSCICEELLGISLSKELQCSDWSVRPLTEDQMTYAAVDALCLIEIFDVFQQRVVKEGNLSEVNNSSSKKVGLKQILWEPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011806`
TK1151 ID	TkA02G611100
OH-1004 ID	LXL04_011806
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 77.948 / OH-1004 58.049 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_011806`
Location	Chr03:679290-684441 (+)
Description	Similar to AAEL005527: Exonuclease mut-7 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_011806` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006139 nucleobase-containing compound metabolic process Biological Process GO:0010526 transposable element silencing Biological Process GO:0035196 miRNA processing Biological Process GO:0044747 pre-miRNA 3'-end processing Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0000175 3'-5'-RNA exonuclease activity Molecular Function GO:0003676 nucleic acid binding Molecular Function GO:0008408 3'-5' exonuclease activity Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	aag:5579811 dme:Dmel_CG9247 hsa:54932 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.531

Rank 1 · LXL04_011806 · OH-1004

Cytoplasm0.442

Rank 2 · LXL04_011806 · OH-1004

Mitochondrion0.093

Rank 3 · LXL04_011806 · OH-1004

Cell membrane0.059

Rank 4 · LXL04_011806 · OH-1004

Endoplasmic reticulum0.046

Rank 5 · LXL04_011806 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01612.27DNA_pol_A_exo136-232 aa

PF01927.23Mut7-C360-516 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011806	`PF01612.27`	DNA_pol_A_exo1	36	232	3.7e-18	66.6
LXL04_011806	`PF01927.23`	Mut7-C	360	516	1.7e-38	132.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card