LXL04_011679 | RubberDandelionOmics

Gene overview

LXL04_011679

Reference: OH-1004 Chr: Chr02 Coordinates: 169278378-169283005 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3783 bp · LXL04_011679|LXL04_011679|OH1004|cDNA

ATGGAGAATCCAATTGACATCGACAAGATAACAGAAACATTGGAACCTGATACAACCGGAGGTGGTGGATTACAATTGCCTGGAAAAGATAGGGTTGTCTTCAGACCGCCTGAGAGGAAATCATTACTAGGACTAGATGCCCTTGCAAGTGCAAAAAGAGCTGAAGGATCCTTTAAAGTTCCTAGAGAAAAAGTTTCTTCTATGATGTCATCTCTAGATGATGAGGTGGAAAAAACCACATCATCAGTCACAGGTCTTGA...

CDS

Download CDS FASTA

3783 bp · LXL04_011679|LXL04_011679|OH1004|CDS

ATGGAGAATCCAATTGACATCGACAAGATAACAGAAACATTGGAACCTGATACAACCGGAGGTGGTGGATTACAATTGCCTGGAAAAGATAGGGTTGTCTTCAGACCGCCTGAGAGGAAATCATTACTAGGACTAGATGCCCTTGCAAGTGCAAAAAGAGCTGAAGGATCCTTTAAAGTTCCTAGAGAAAAAGTTTCTTCTATGATGTCATCTCTAGATGATGAGGTGGAAAAAACCACATCATCAGTCACAGGTCTTGA...

Protein

Download Protein FASTA

1260 aa · LXL04_011679|LXL04_011679|OH1004|PROTEIN

MENPIDIDKITETLEPDTTGGGGLQLPGKDRVVFRPPERKSLLGLDALASAKRAEGSFKVPREKVSSMMSSLDDEVEKTTSSVTGLDEVGSGVSSSGRNYTSRQYRDSSGSKTFGSESQINEEERVPRHGSNSNTRSEDVTPSSRSSRSSQHRSHRNDSADYDRRRNDSRDDRGSSRRYYSSDRDERDHVDPSPRYGKDYRDYGNKRSRYESSSRRTPGRSDWDDGRWEWEESPRHDSRHRQPSRSPMLLGASPDARLVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011679`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011679

Location Chr02:169278378-169283005 (+)

Description Similar to CUV: Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g13010`	Involved in pre-mRNA splicing by mediating structural transitions of the spliceosome during the catalytic step.	Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.2015 · DOI: 10.1073/pnas.1421475112

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011679 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000350 generation of catalytic spliceosome for second transesterification step Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010467 gene expression Biological Process

GO:0031053 primary miRNA processing Biological Process

GO:0031334 positive regulation of protein-containing complex assembly Biological Process

GO:0033120 positive regulation of RNA splicing Biological Process

GO:0035194 regulatory ncRNA-mediated post-transcriptional gene silencing Biological Process

GO:0045087 innate immune response Biological Process

KEGG gene cross-reference

ath:AT5G13010

bta:520046

cel:CELE_K03H1.2

hsa:9785

spo:2540006

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.901

Rank 1 · LXL04_011679 · OH-1004

Cytoplasm0.177

Rank 2 · LXL04_011679 · OH-1004

Mitochondrion0.024

Rank 3 · LXL04_011679 · OH-1004

Cell membrane0.023

Rank 4 · LXL04_011679 · OH-1004

Endoplasmic reticulum0.014

Rank 5 · LXL04_011679 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD570-720 aa

PF13401.13AAA_22577-710 aa

PF00271.38Helicase_C767-896 aa

PF04408.30WHD_HA2961-986 aa

PF21010.3HA2_C987-1046 aa

PF07717.23OB_NTP_bind1104-1181 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011679	`PF00270.36`	DEAD	570	720	3.9e-09	37.2
LXL04_011679	`PF13401.13`	AAA_22	577	710	2.1e-06	28.8
LXL04_011679	`PF00271.38`	Helicase_C	767	896	9.2e-11	42.7
LXL04_011679	`PF04408.30`	WHD_HA2	961	986	3.1e-08	34.2
LXL04_011679	`PF21010.3`	HA2_C	987	1046	1.6e-14	54.9
LXL04_011679	`PF07717.23`	OB_NTP_bind	1104	1181	3.9e-19	69.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K2E9`	Arabidopsis thaliana	Pre-mRNA-splicing factor ATP-dependent RNA helicase DEAH7	74.863%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card