LXL04_011662 | RubberDandelionOmics

Gene overview

LXL04_011662

Reference: OH-1004 Chr: Chr02 Coordinates: 169023145-169028285 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3168 bp · LXL04_011662|LXL04_011662|OH1004|cDNA

ATGGAAAAATCTGATTCAGACTCCGATGGATCTCACGTTTCGTCCACGCCTCCTCGTCAACCATATCGGCCTCCTCCCCTTCTCTCTCGGCCACCCCCACCGCCGGCACCACATACTCTTCTGTTTTCTGGTAAGCAACCAAAAGACCCCAAATCAAAAGCCAAATCCAGTTCTTCCCGGCCAATTTTGAGAATTAAACCATCCACCAGGAAAATTAAGCCACCTCCTCCGAAATCTACACTTAAAATCGATGAAAATGA...

CDS

Download CDS FASTA

3168 bp · LXL04_011662|LXL04_011662|OH1004|CDS

ATGGAAAAATCTGATTCAGACTCCGATGGATCTCACGTTTCGTCCACGCCTCCTCGTCAACCATATCGGCCTCCTCCCCTTCTCTCTCGGCCACCCCCACCGCCGGCACCACATACTCTTCTGTTTTCTGGTAAGCAACCAAAAGACCCCAAATCAAAAGCCAAATCCAGTTCTTCCCGGCCAATTTTGAGAATTAAACCATCCACCAGGAAAATTAAGCCACCTCCTCCGAAATCTACACTTAAAATCGATGAAAATGA...

Protein

Download Protein FASTA

1055 aa · LXL04_011662|LXL04_011662|OH1004|PROTEIN

MEKSDSDSDGSHVSSTPPRQPYRPPPLLSRPPPPPAPHTLLFSGKQPKDPKSKAKSSSSRPILRIKPSTRKIKPPPPKSTLKIDENDQLQGPTPPTMRSSDADLQFQNNRSSECDSFSSIASTETHPAKLSFQIHRSSGCDASVSTTPIEPLPTKLSFQMRRSSGCDTFVSTNPTEPLPAIITGVRPSFSKMRRACLNFESTENGIDHGLEAKVGGSYSQAGDANVTDSEKIVDNHPNLIGSCTSRLEHANTSDTTRVNK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011662`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011662

Location Chr02:169023145-169028285 (+)

Description Similar to RECQL5: ATP-dependent DNA helicase Q-like 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27880`	3'-5' DNA helicase that may play a role in the repair of DNA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011662 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009432 SOS response Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0043473 pigmentation Biological Process

GO:0045875 negative regulation of sister chromatid cohesion Biological Process

GO:0061820 telomeric D-loop disassembly Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

KEGG gene cross-reference

ath:AT1G27880

hin:HI_0728

hsa:9401

mmu:79456

pmu:PM1427

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.883

Rank 1 · LXL04_011662 · OH-1004

Cytoplasm0.131

Rank 2 · LXL04_011662 · OH-1004

Cell membrane0.032

Rank 3 · LXL04_011662 · OH-1004

Mitochondrion0.024

Rank 4 · LXL04_011662 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_011662 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD410-574 aa

PF00271.38Helicase_C630-728 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011662	`PF00270.36`	DEAD	410	574	7.8e-23	81.7
LXL04_011662	`PF00271.38`	Helicase_C	630	728	4.3e-20	72.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WVW7`	Arabidopsis thaliana	ATP-dependent DNA helicase Q-like 5	58.438%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card