LXL04_011496 | RubberDandelionOmics

Gene overview

LXL04_011496

Reference: OH-1004 Chr: Chr02 Coordinates: 165693284-165697046 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2148 bp · LXL04_011496|LXL04_011496|OH1004|cDNA

ATGAAGGAAAATCGCATCTTTCTAGCTTTCTTTTCTCTCATTCTCGTTCCTTCTTCTATTGCGCAACTAAATACAGGGGATTCGAGAATCCTTTTTCAAGTTCAACAAAAGCTTGAGTACCCGCAAGTTCTTCAAGAATGGGGAAATTGGACAAATTTCTGCTTTCTGCCTTCAAATCCGAATCTAATGATTGTTTGTTCAGGTAATCGTATCACTGAATTAACCATCGTTGGAAACAAAACGAAAGCACTTTCTGCAAG...

CDS

Download CDS FASTA

2148 bp · LXL04_011496|LXL04_011496|OH1004|CDS

ATGAAGGAAAATCGCATCTTTCTAGCTTTCTTTTCTCTCATTCTCGTTCCTTCTTCTATTGCGCAACTAAATACAGGGGATTCGAGAATCCTTTTTCAAGTTCAACAAAAGCTTGAGTACCCGCAAGTTCTTCAAGAATGGGGAAATTGGACAAATTTCTGCTTTCTGCCTTCAAATCCGAATCTAATGATTGTTTGTTCAGGTAATCGTATCACTGAATTAACCATCGTTGGAAACAAAACGAAAGCACTTTCTGCAAG...

Protein

Download Protein FASTA

715 aa · LXL04_011496|LXL04_011496|OH1004|PROTEIN

MKENRIFLAFFSLILVPSSIAQLNTGDSRILFQVQQKLEYPQVLQEWGNWTNFCFLPSNPNLMIVCSGNRITELTIVGNKTKALSASFSIDSFFTDLTKLSTLKKLTLVSLGLWGILPPKVDRFWSLEVMNFSSNSINGEIPSTILSIKNLTVVDLSNNYFSGSVPDLKWLPNLQVIDLGSNRLGPEYPSMGYNLVSITLKNNSIRNQFPSDFAKFVRLQRLDISSNKLVGPIPSSLFSLSSIQYLNLGSNQFSGALPAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011496`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011496

Location Chr02:165693284-165697046 (+)

Description Similar to At1g14390: Probable LRR receptor-like serine/threonine-protein kinase At1g14390

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14390`	Probable LRR receptor-like serine/threonine-protein kinase At1g14390.	No verified direct reference in this release
`At2g02780`	Probable LRR receptor-like serine/threonine-protein kinase At2g02780.	No verified direct reference in this release
`At3g03770`	Probable inactive leucine-rich repeat receptor-like protein kinase At3g03770.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011496 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009416 response to light stimulus Biological Process

GO:0009729 detection of brassinosteroid stimulus Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005496 steroid binding Molecular Function

KEGG gene cross-reference

ath:AT1G14390

ath:AT2G02780

ath:AT3G03770

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.854

Rank 1 · LXL04_011496 · OH-1004

Endoplasmic reticulum0.073

Rank 2 · LXL04_011496 · OH-1004

Cytoplasm0.063

Rank 3 · LXL04_011496 · OH-1004

Nucleus0.047

Rank 4 · LXL04_011496 · OH-1004

Lysosome / Vacuole0.030

Rank 5 · LXL04_011496 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12799.14LRR_4149-184 aa

PF13855.13LRR_8172-229 aa

PF00069.32Pkinase429-692 aa

PF07714.24PK_Tyr_Ser-Thr431-629 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011496	`PF12799.14`	LRR_4	149	184	3.1e-09	37.5
LXL04_011496	`PF13855.13`	LRR_8	172	229	4.8e-11	43.0
LXL04_011496	`PF00069.32`	Pkinase	429	692	2.6e-18	67.1
LXL04_011496	`PF07714.24`	PK_Tyr_Ser-Thr	431	629	1e-19	71.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9S4`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At1g14390	51.404%	Swiss-Prot	strong database homology
`C0LGJ9`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At2g02780	48.607%	Swiss-Prot	moderate database homology
`Q8LFN2`	Arabidopsis thaliana	Probable inactive leucine-rich repeat receptor-like protein kinase At3g03770	41.304%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card