LXL04_011260 | RubberDandelionOmics

Gene overview

LXL04_011260

Reference: OH-1004 Chr: Chr02 Coordinates: 161254209-161255666 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1458 bp · LXL04_011260|LXL04_011260|OH1004|cDNA

ATGCTCCCGTCTGCAAAACGTTCTTATCTCATCAACCATGTCCCCAAGCTTCTCTTCATAACACTAATCATCGCTATCATCATTCAAGCATTCATCAAGAATGCCCCATATCACCACCTTCTTACTCGCCATTCCCTCATCTACACACTAACTTTCTCTTTGCTACCCATCTCCATTCTCATATTCCACTTCTTGAACAAACCTCGGACCATCTACCTCGTCGACTTCGCTTGTTTCAAACCACCTTCCATTCTCCGAGT...

CDS

Download CDS FASTA

1458 bp · LXL04_011260|LXL04_011260|OH1004|CDS

ATGCTCCCGTCTGCAAAACGTTCTTATCTCATCAACCATGTCCCCAAGCTTCTCTTCATAACACTAATCATCGCTATCATCATTCAAGCATTCATCAAGAATGCCCCATATCACCACCTTCTTACTCGCCATTCCCTCATCTACACACTAACTTTCTCTTTGCTACCCATCTCCATTCTCATATTCCACTTCTTGAACAAACCTCGGACCATCTACCTCGTCGACTTCGCTTGTTTCAAACCACCTTCCATTCTCCGAGT...

Protein

Download Protein FASTA

485 aa · LXL04_011260|LXL04_011260|OH1004|PROTEIN

MLPSAKRSYLINHVPKLLFITLIIAIIIQAFIKNAPYHHLLTRHSLIYTLTFSLLPISILIFHFLNKPRTIYLVDFACFKPPSILRVPFSTALEHGQIILASQPKSLKFQLMILERSGLGEETCLPHPLHYLPSKPDMMDARDETELVIFSAMDSLFQQTGIDPKDIDILIVNCSLFSPTPSISAMVVNKYKMRSNIKSFNLAGMGCSAGLISIDFAKNLLQVHPESYAVVISTEILSPNSYMGKERSMLLPNCLFRMGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011260`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011260

Location Chr02:161254209-161255666 (+)

Description Similar to CUT1: 3-ketoacyl-CoA synthase 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68530`	Contributes to cuticular wax and suberin biosynthesis.	CUT1, an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme.1999 · DOI: 10.1105/tpc.11.5.825 Alterations in CER6, a gene identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems.2000 · DOI: 10.1105/tpc.12.10.2001
`At1g25450`	Mediates mostly the synthesis of very-long-chain fatty acids (VLCFAs) from 26 to 30 carbons in length.	Specific and differential inhibition of very-long-chain fatty acid elongases from Arabidopsis thaliana by different herbicides.2004 · DOI: 10.1073/pnas.0404600101
`At2g16280`	Involved in the elongation of C22 to C24 fatty acids, which are precursors for the biosynthesis of cuticular waxes, aliphatic suberins, and membrane lipids, including sphingolipids and phospholipids.	Arabidopsis 3-ketoacyl-coenzyme a synthase9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids.2013 · DOI: 10.1104/pp.112.210450
`At1g19440`	3-ketoacyl-CoA synthase 4.	No verified direct reference in this release
`At4g34510`	Active on saturated acyl-CoAs up to C22.	Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases.2006 · DOI: 10.1016/j.bbrc.2006.05.162

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011260 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000038 very long-chain fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010025 wax biosynthetic process Biological Process

GO:0030497 fatty acid elongation Biological Process

GO:0048868 pollen tube development Biological Process

GO:0160062 cutin-based cuticle development Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G19440

ath:AT1G25450

ath:AT1G68530

ath:AT2G16280

ath:AT4G34510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.848

Rank 1 · LXL04_011260 · OH-1004

Cell membrane0.057

Rank 2 · LXL04_011260 · OH-1004

Cytoplasm0.051

Rank 3 · LXL04_011260 · OH-1004

Nucleus0.041

Rank 4 · LXL04_011260 · OH-1004

Golgi apparatus0.038

Rank 5 · LXL04_011260 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08392.19FAE1_CUT1_RppA65-351 aa

PF08541.17ACP_syn_III_C368-449 aa

PF02797.22Chal_sti_synt_C371-441 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011260	`PF08392.19`	FAE1_CUT1_RppA	65	351	2.8e-129	431.3
LXL04_011260	`PF08541.17`	ACP_syn_III_C	368	449	1.7e-13	51.3
LXL04_011260	`PF02797.22`	Chal_sti_synt_C	371	441	9.8e-10	39.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XF43`	Arabidopsis thaliana	3-ketoacyl-CoA synthase 6	65.739%	Swiss-Prot	strong database homology
`Q9C6L5`	Arabidopsis thaliana	3-ketoacyl-CoA synthase 5	65.525%	Swiss-Prot	strong database homology
`Q9SIX1`	Arabidopsis thaliana	3-ketoacyl-CoA synthase 9	56.867%	Swiss-Prot	strong database homology
`Q9LN49`	Arabidopsis thaliana	3-ketoacyl-CoA synthase 4	54.604%	Swiss-Prot	strong database homology
`O65677`	Arabidopsis thaliana	3-ketoacyl-CoA synthase 17	54.526%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card