LXL04_010992 | RubberDandelionOmics

Gene overview

LXL04_010992

Reference: OH-1004 Chr: Chr02 Coordinates: 156178366-156180296 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1670 bp · LXL04_010992|LXL04_010992|OH1004|cDNA

ATGAATTCGGAGAAAGTTTACAGTAGCAAGTCCTTGAAACGCttaaacaacaacaacaacaagaaATTAAAACCCTCTCATATCCCAAACCTACCTTCCGAACACGCAAACCCCAGCCAGGTAGGAGTTATGGGTTCTCGAGCTCTTCCTGGAAACGGAGGAGGTAAGTTTGGGTTTAGAAGGCAGGAGAATCGAGTTACAATCCAGCTAACATCCAAATCGAAGCAAGAGATGAAGGAAATCAAGAGGAAGCTTGTGAG...

CDS

Download CDS FASTA

1512 bp · LXL04_010992|LXL04_010992|OH1004|CDS

ATGAATTCGGAGAAAGTTTACAGTAGCAAGTCCTTGAAACGCTTAAACAACAACAACAACAAGAAATTAAAACCCTCTCATATCCCAAACCTACCTTCCGAACACGCAAACCCCAGCCAGGTAGGAGTTATGGGTTCTCGAGCTCTTCCTGGAAACGGAGGAGGTAAGTTTGGGTTTAGAAGGCAGGAGAATCGAGTTACAATCCAGCTAACATCCAAATCGAAGCAAGAGATGAAGGAAATCAAGAGGAAGCTTGTGAG...

Protein

Download Protein FASTA

503 aa · LXL04_010992|LXL04_010992|OH1004|PROTEIN

MNSEKVYSSKSLKRLNNNNNKKLKPSHIPNLPSEHANPSQVGVMGSRALPGNGGGKFGFRRQENRVTIQLTSKSKQEMKEIKRKLVSELELVKRLVKKIEEVGSRPLNQLSISVLENTHGTSENVEKDKRTPKANQFYRKSDFLLAKDRIPATESNKKPKPGASKKQGGADAKFSNKLFKSCSTLLEKLMKHKHGWVFNKPVDPLALGLHDYFDIIKHPMDLETVKSRLDKNWYNSPMEFAEDVRLTFHNAMTYNPKGQD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010992`
TK1151 ID	TkA03G559720
OH-1004 ID	LXL04_010992
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.400
Protein coverage (%)	TK1151 89.643 / OH-1004 53.479 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010992

Location Chr02:156178366-156180296 (-)

Description Similar to GTE4: Transcription factor GTE4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g06230`	Involved in the activation and maintenance of cell division in the meristems and by this controls cell numbers in differentiated organs.	The Arabidopsis BET bromodomain factor GTE4 is involved in maintenance of the mitotic cell cycle during plant development.2010 · DOI: 10.1104/pp.109.150631 The Arabidopsis BET bromodomain factor GTE4 regulates the mitotic cell cycle.2010 · DOI: 10.4161/psb.5.6.11571
`At1g73150`	Probable transcription factor that binds to acetylated histone H3.	The PHD domain of plant PIAS proteins mediates sumoylation of bromodomain GTE proteins.2008 · DOI: 10.1074/jbc.m708176200
`At1g17790`	Transcription factor GTE5, chloroplastic.	No verified direct reference in this release
`At5g14270`	Transcription factor GTE9.	No verified direct reference in this release
`UniProt: Q9FGW9`	Acts as a negative regulator in plant response to changes in environmental conditions through the control of ABA-regulated gene expression.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010992 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0009409 response to cold Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045931 positive regulation of mitotic cell cycle Biological Process

GO:0048364 root development Biological Process

KEGG gene cross-reference

ath:AT1G06230

ath:AT1G17790

ath:AT1G73150

ath:AT5G14270

ath:AT5G63320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976

Rank 1 · LXL04_010992 · OH-1004

Cytoplasm0.072

Rank 2 · LXL04_010992 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_010992 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_010992 · OH-1004

Plastid0.010

Rank 5 · LXL04_010992 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00439.31Bromodomain182-266 aa

PF17035.11BET348-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010992	`PF00439.31`	Bromodomain	182	266	1.1e-20	74.0
LXL04_010992	`PF17035.11`	BET	348	410	8.5e-25	87.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNC4`	Arabidopsis thaliana	Transcription factor GTE4	49.882%	Swiss-Prot	moderate database homology
`Q9S7T1`	Arabidopsis thaliana	Transcription factor GTE3, chloroplastic	43.264%	Swiss-Prot	moderate database homology
`Q8H1D7`	Arabidopsis thaliana	Transcription factor GTE5, chloroplastic	37.410%	Swiss-Prot	moderate database homology
`Q93YS6`	Arabidopsis thaliana	Transcription factor GTE9	36.226%	Swiss-Prot	moderate database homology
`Q9FGW9`	Arabidopsis thaliana	Transcription factor GTE10	30.493%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card