LXL04_010745 | RubberDandelionOmics

Gene overview

LXL04_010745

Reference: OH-1004 Chr: Chr02 Coordinates: 152489640-152492338 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1311 bp · LXL04_010745|LXL04_010745|OH1004|cDNA

ATGTACTTTACGACAACAGAGGATAGGACAGATGGAAGCCCTAGACTATCGAAATCATCAAAAGCATCGCACCACCATGTATTCTTTGATCCCTTTCTCCAGCAATACTTCAATTTTTTCGTTCCTTTCATAGTCTCTGCAACCACCGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCGTGGGTCCCACCATTGTCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCA...

CDS

Download CDS FASTA

1311 bp · LXL04_010745|LXL04_010745|OH1004|CDS

ATGTACTTTACGACAACAGAGGATAGGACAGATGGAAGCCCTAGACTATCGAAATCATCAAAAGCATCGCACCACCATGTATTCTTTGATCCCTTTCTCCAGCAATACTTCAATTTTTTCGTTCCTTTCATAGTCTCTGCAACCACCGTCATTCTTTGTATGAATATGATGATGCGCCCAATGAATCCACCTCCACCTGCACCGTGGGTCCCACCATTGTCCCCAATGACAAGTGGCTTTTGGAACGCTACAAATGTTCA...

Protein

Download Protein FASTA

436 aa · LXL04_010745|LXL04_010745|OH1004|PROTEIN

MYFTTTEDRTDGSPRLSKSSKASHHHVFFDPFLQQYFNFFVPFIVSATTVILCMNMMMRPMNPPPPAPWVPPLSPMTSGFWNATNVQSSLKELQNTIDLAEAMEKELGMLMAIKDGKNHIEETEEKPNETSMEKFSNFIKNNKISIETQEKFSLEAANNLIAKLKNDLQPFKVITDDKTPWEEKSAAVKLANKLKKHKRNKLWRKRKRQHIGELLPKEREQSDQADREADEWRAREIANETAKQRVEKMKEIAKQKAKEE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010745`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010745

Location Chr02:152489640-152492338 (-)

Description Similar to SNRNP59: U11/U12 small nuclear ribonucleoprotein 59 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g46200`	U11/U12 small nuclear ribonucleoprotein 59 kDa protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010745 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0008380 RNA splicing Biological Process

GO:0051384 response to glucocorticoid Biological Process

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0034693 U11/U12 snRNP Cellular Component

GO:0071016 U12-type precatalytic spliceosome Cellular Component

GO:0089701 U2AF complex Cellular Component

KEGG gene cross-reference

ath:AT2G46200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.829

Rank 1 · LXL04_010745 · OH-1004

Cytoplasm0.215

Rank 2 · LXL04_010745 · OH-1004

Cell membrane0.044

Rank 3 · LXL04_010745 · OH-1004

Mitochondrion0.023

Rank 4 · LXL04_010745 · OH-1004

Endoplasmic reticulum0.019

Rank 5 · LXL04_010745 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16021.11PDCD7182-432 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010745	`PF16021.11`	PDCD7	182	432	8e-23	81.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYD3`	Arabidopsis thaliana	U11/U12 small nuclear ribonucleoprotein 59 kDa protein	49.482%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card