LXL04_010631 | RubberDandelionOmics

Gene overview

LXL04_010631

Reference: OH-1004 Chr: Chr02 Coordinates: 150113164-150116933 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1491 bp · LXL04_010631|LXL04_010631|OH1004|cDNA

ATGGAAGTTCAATCGCGAATCGGGAGTACCCGATCTCTCGATCCCGACGGAAGAGGAGGACAGCTCCGATTTTTGCTGAAAGGTCCCTTACTTCACGAAGGGCAGACGCGTCGCTGCTCACCTCCGTCACTTCTTCCAGGCGATTCGCCGCCGTGTTGGCCGGAGTCTGAGACCATGTGGAGAAGGGGAAACTCACTGAGTCGATTCACTCACCTCACCACCTCCTCGTCGTCCAAGTTCAATAGCCATCTAAACCTTCA...

CDS

Download CDS FASTA

1491 bp · LXL04_010631|LXL04_010631|OH1004|CDS

ATGGAAGTTCAATCGCGAATCGGGAGTACCCGATCTCTCGATCCCGACGGAAGAGGAGGACAGCTCCGATTTTTGCTGAAAGGTCCCTTACTTCACGAAGGGCAGACGCGTCGCTGCTCACCTCCGTCACTTCTTCCAGGCGATTCGCCGCCGTGTTGGCCGGAGTCTGAGACCATGTGGAGAAGGGGAAACTCACTGAGTCGATTCACTCACCTCACCACCTCCTCGTCGTCCAAGTTCAATAGCCATCTAAACCTTCA...

Protein

Download Protein FASTA

496 aa · LXL04_010631|LXL04_010631|OH1004|PROTEIN

MEVQSRIGSTRSLDPDGRGGQLRFLLKGPLLHEGQTRRCSPPSLLPGDSPPCWPESETMWRRGNSLSRFTHLTTSSSSKFNSHLNLQPNSLRLLQISDVDHGYGLFSRSTSTTVGPSSGPGKLGIAGLDRVRAMGSTADIVDATTLGAREIVDMARHYGRCYWELSKAKLSMLVVATSGAGYVLGSGSTVDLAGLCYTCAGTMMVAASANTLNQVFEVKNDALMNRTMRRPLPSGRLSIPHAVVWAASSGLAGTALLATQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010631`
TK1151 ID	TkA03G538630
OH-1004 ID	LXL04_010631
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010631

Location Chr02:150113164-150116933 (-)

Description Similar to COX10: Protoheme IX farnesyltransferase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g44520`	Converts protoheme IX and farnesyl diphosphate to heme O.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010631 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000266 mitochondrial fission Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0006784 heme A biosynthetic process Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0008535 respiratory chain complex IV assembly Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0017004 cytochrome complex assembly Biological Process

GO:0018343 protein farnesylation Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0048034 heme O biosynthetic process Biological Process

GO:0055070 copper ion homeostasis Biological Process

KEGG gene cross-reference

ath:AT2G44520

hsa:1352

mmu:70383

pon:100174049

sus:Acid_4382

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.905

Rank 1 · LXL04_010631 · OH-1004

Nucleus0.049

Rank 2 · LXL04_010631 · OH-1004

Cytoplasm0.047

Rank 3 · LXL04_010631 · OH-1004

Plastid0.038

Rank 4 · LXL04_010631 · OH-1004

Cell membrane0.021

Rank 5 · LXL04_010631 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01040.24UbiA175-423 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010631	`PF01040.24`	UbiA	175	423	6.7e-52	177.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64886`	Arabidopsis thaliana	Protoheme IX farnesyltransferase, mitochondrial	67.147%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card