LXL04_010227 | RubberDandelionOmics

Gene overview

LXL04_010227

Reference: OH-1004 Chr: Chr02 Coordinates: 142539205-142542300 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · LXL04_010227|LXL04_010227|OH1004|cDNA

ATGCCTCAAGTGAGGATTATAGCTAAGAACTTCATGGACATGGTGTCCTCCTTACCTGCGATGAAGCTTGACAAGCTATACGAGAATGCATTCATTTGTGAAGCTATTCTCAGGTCTTTGCCACCATTGGCAAAAAAGTATGTTCTTCAATTGCTGTACATAGATGTGCCTGTGACAGCCAGTTCAATGCAAGAGTGGGTTCTTGCTGATGGTGCTTCAAAGCATAGAGTTGCCATTGATAGACTCATTCAATTGAGAGT...

CDS

Download CDS FASTA

1359 bp · LXL04_010227|LXL04_010227|OH1004|CDS

ATGCCTCAAGTGAGGATTATAGCTAAGAACTTCATGGACATGGTGTCCTCCTTACCTGCGATGAAGCTTGACAAGCTATACGAGAATGCATTCATTTGTGAAGCTATTCTCAGGTCTTTGCCACCATTGGCAAAAAAGTATGTTCTTCAATTGCTGTACATAGATGTGCCTGTGACAGCCAGTTCAATGCAAGAGTGGGTTCTTGCTGATGGTGCTTCAAAGCATAGAGTTGCCATTGATAGACTCATTCAATTGAGAGT...

Protein

Download Protein FASTA

452 aa · LXL04_010227|LXL04_010227|OH1004|PROTEIN

MPQVRIIAKNFMDMVSSLPAMKLDKLYENAFICEAILRSLPPLAKKYVLQLLYIDVPVTASSMQEWVLADGASKHRVAIDRLIQLRVFTETVDRKKEATYRLNPMFQMNLRTHIVHGGVLPREPMAANITVRLPSLEELDSYAAQQWECFLLHLINSAEVEVTTKSISPSMMKVFQRGLLSQKDNDGSRLTESGFQFLLMDTNAQLWYIIREYISNSEDRGVDSADLISFLLELSFHVTGEAYNMNTLDEIQRITVKDLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010227`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010227

Location Chr02:142539205-142542300 (-)

Description Similar to TFB2: General transcription and DNA repair factor IIH subunit TFB2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17020`	Component of the general transcription and DNA repair factor IIH (TFIIH) core complex, which is involved in general and transcription-coupled nucleotide excision repair (NER) of damaged DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010227 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006366 transcription by RNA polymerase II Biological Process

GO:0006367 transcription initiation at RNA polymerase II promoter Biological Process

GO:0000112 nucleotide-excision repair factor 3 complex Cellular Component

GO:0000438 core TFIIH complex portion of holo TFIIH complex Cellular Component

GO:0000439 transcription factor TFIIH core complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005669 transcription factor TFIID complex Cellular Component

GO:0005675 transcription factor TFIIH holo complex Cellular Component

KEGG gene cross-reference

ath:AT4G17020

hsa:2968

mmu:14885

ptr:462549

spo:2539790

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.649

Rank 1 · LXL04_010227 · OH-1004

Nucleus0.322

Rank 2 · LXL04_010227 · OH-1004

Lysosome / Vacuole0.078

Rank 3 · LXL04_010227 · OH-1004

Golgi apparatus0.074

Rank 4 · LXL04_010227 · OH-1004

Cell membrane0.061

Rank 5 · LXL04_010227 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03849.20Tfb214-367 aa

PF18307.7Tfb2_C382-448 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010227	`PF03849.20`	Tfb2	14	367	3.6e-112	375.6
LXL04_010227	`PF18307.7`	Tfb2_C	382	448	1.1e-21	77.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q680U9`	Arabidopsis thaliana	General transcription and DNA repair factor IIH subunit TFB2	75.831%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card