Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1491 bp · LXL04_010149|LXL04_010149|OH1004|cDNA
ATGGAACAACAACATATAGTCTCCGATGACGTACTCGTCAGCGGTGGCAAAACATCACTGACGCTCTCTGTTGACGGGATACTCCAATGGTCAGATGGAGGCTTAATTCACCGGTGCTTGTCTGTAGAGAAGGAAGTTCTTGGATTTTCAAAGGTTGGACGCCTGATCACAATTAGGGCACTTGTTCCAACAGGTGGTGATCGATTTTGCTTCGGAAGTAGTGGCGACGGGAGTTTGACGAGGAAGAGCTTCTTATTTGA...
1491 bp · LXL04_010149|LXL04_010149|OH1004|CDS
ATGGAACAACAACATATAGTCTCCGATGACGTACTCGTCAGCGGTGGCAAAACATCACTGACGCTCTCTGTTGACGGGATACTCCAATGGTCAGATGGAGGCTTAATTCACCGGTGCTTGTCTGTAGAGAAGGAAGTTCTTGGATTTTCAAAGGTTGGACGCCTGATCACAATTAGGGCACTTGTTCCAACAGGTGGTGATCGATTTTGCTTCGGAAGTAGTGGCGACGGGAGTTTGACGAGGAAGAGCTTCTTATTTGA...
Protein
Download Protein FASTA496 aa · LXL04_010149|LXL04_010149|OH1004|PROTEIN
MEQQHIVSDDVLVSGGKTSLTLSVDGILQWSDGGLIHRCLSVEKEVLGFSKVGRLITIRALVPTGGDRFCFGSSGDGSLTRKSFLFEAVNENSLRNLCEKIQAYIDSLGRPKKLFIFVNPFGGRKSASKIFTNDVKPILEDANIDYTLQETRYQLHAKELSRSLDLTKYDGIICVSGDGILVEVVNGLLEREDWAIALKIPLGVIPAGTGNGMIKSLLDSVGQPCTPLHATLAAVRGHKRCLDVATIWQGETAFFSVLML...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_010149 |
|---|---|
| TK1151 ID | TkA03G507670 |
| OH-1004 ID | LXL04_010149 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 95.700 |
| Protein coverage (%) | TK1151 98.732 / OH-1004 98.387Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_010149 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr02:141060104-141062653 (+) | |||||||||
| Description | Similar to SPHK1: Sphingosine kinase 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006473 protein acetylation Biological Process GO:0006648 dihydrosphingosine-1-P pathway Biological Process GO:0006665 sphingolipid metabolic process Biological Process GO:0006670 sphingosine metabolic process Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009845 seed germination Biological Process GO:0010803 regulation of tumor necrosis factor-mediated signaling pathway Biological Process GO:0019722 calcium-mediated signaling Biological Process GO:0030100 regulation of endocytosis Biological Process GO:0030148 sphingolipid biosynthetic process Biological Process GO:0030307 positive regulation of cell growth Biological Process GO:0030335 positive regulation of cell migration Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT4G21534 ath:AT4G21540 ddi:DDB_G0272522 hsa:8877 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00781.30DAGK_cat113-246 aaPF19280.5CERK_C272-389 aaPF19279.5YegS_C364-417 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_010149 | PF00781.30 | DAGK_cat | 113 | 246 | 2.3e-28 | 99.0 |
| LXL04_010149 | PF19280.5 | CERK_C | 272 | 389 | 2e-06 | 28.2 |
| LXL04_010149 | PF19279.5 | YegS_C | 364 | 417 | 3.3e-10 | 40.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.