LXL04_010119 | RubberDandelionOmics

Gene overview

LXL04_010119

Reference: OH-1004 Chr: Chr02 Coordinates: 140498196-140514919 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5637 bp · LXL04_010119|LXL04_010119|OH1004|cDNA

ATGGTATTGGCCCCTCTCATTTTATCGCTACAAGTTGGTGTCCTTTGTTTTACCAACCAAGACAAACTTAAGGTCAGACATGCAACAGCTTTAAAGGAAAAATTCTGCACTTCTACCGACTCCATCACACTCACTCATCCCCTTAAAGATGGCGATGTTTTGGTCTCAGATGGAGAAACTTTCGCGCTTGGATTCTTTAGCCCAAGAAATTCCAGCGACCGCTATGTGGGTATCTGGTACAACAAGGTGTCGGAGCAAAC...

CDS

Download CDS FASTA

5637 bp · LXL04_010119|LXL04_010119|OH1004|CDS

ATGGTATTGGCCCCTCTCATTTTATCGCTACAAGTTGGTGTCCTTTGTTTTACCAACCAAGACAAACTTAAGGTCAGACATGCAACAGCTTTAAAGGAAAAATTCTGCACTTCTACCGACTCCATCACACTCACTCATCCCCTTAAAGATGGCGATGTTTTGGTCTCAGATGGAGAAACTTTCGCGCTTGGATTCTTTAGCCCAAGAAATTCCAGCGACCGCTATGTGGGTATCTGGTACAACAAGGTGTCGGAGCAAAC...

Protein

Download Protein FASTA

1878 aa · LXL04_010119|LXL04_010119|OH1004|PROTEIN

MVLAPLILSLQVGVLCFTNQDKLKVRHATALKEKFCTSTDSITLTHPLKDGDVLVSDGETFALGFFSPRNSSDRYVGIWYNKVSEQTVVWVANRDRPITNSTGILSLDETGNLVLRESGQPFVFWSTNVSGVVNNDVDSAKLLDSGNLVLFQGQNREVYSWQSFDYPSNTILPGSKFGVDKKTGLNREATSWITNGNPGVGEYSFKMEIVGSPQLFLYQDTTPIWRGGSWTGHGWSGIPEMTHIYLFNVTYTNNNDEVAL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010119`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010119

Location Chr02:140498196-140514919 (-)

Description Similar to RKS1: G-type lectin S-receptor-like serine/threonine-protein kinase RKS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11340`	G-type lectin S-receptor-like serine/threonine-protein kinase RKS1.	No verified direct reference in this release
`At1g11410`	G-type lectin S-receptor-like serine/threonine-protein kinase At1g11410.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At1g65800`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At1g65790`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010119 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004675 transmembrane receptor protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G11340

ath:AT1G11410

ath:AT4G21380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.863

Rank 1 · LXL04_010119 · OH-1004

Endoplasmic reticulum0.083

Rank 2 · LXL04_010119 · OH-1004

Cytoplasm0.072

Rank 3 · LXL04_010119 · OH-1004

Nucleus0.046

Rank 4 · LXL04_010119 · OH-1004

Lysosome / Vacuole0.024

Rank 5 · LXL04_010119 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453.31B_lectin87-192 aa

PF00954.26S_locus_glycop225-335 aa

PF08276.18PAN_2358-424 aa

PF00069.32Pkinase536-735 aa

PF07714.24PK_Tyr_Ser-Thr538-797 aa

PF01453.31B_lectin1111-1217 aa

PF00954.26S_locus_glycop1249-1359 aa

PF08276.18PAN_21382-1447 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010119	`PF01453.31`	B_lectin	87	192	7.5e-65	216.7
LXL04_010119	`PF00954.26`	S_locus_glycop	225	335	5.1e-64	214.5
LXL04_010119	`PF08276.18`	PAN_2	358	424	6.8e-38	129.3
LXL04_010119	`PF00069.32`	Pkinase	536	735	1.4e-85	287.6
LXL04_010119	`PF07714.24`	PK_Tyr_Ser-Thr	538	797	8.5e-90	301.3
LXL04_010119	`PF01453.31`	B_lectin	1111	1217	7.5e-65	216.7
LXL04_010119	`PF00954.26`	S_locus_glycop	1249	1359	5.1e-64	214.5
LXL04_010119	`PF08276.18`	PAN_2	1382	1447	6.8e-38	129.3
LXL04_010119	`PF07714.24`	PK_Tyr_Ser-Thr	1561	1824	8.5e-90	301.3
LXL04_010119	`PF00069.32`	Pkinase	1561	1758	1.4e-85	287.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT07`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase RKS1	50.485%	Swiss-Prot	weak database homology
`Q9LPZ3`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase At1g11410	50.300%	Swiss-Prot	weak database homology
`O81905`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-8	45.520%	Swiss-Prot	weak database homology
`Q9S972`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-6	45.432%	Swiss-Prot	weak database homology
`Q39086`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-7	44.005%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card