LXL04_010050 | RubberDandelionOmics

Gene overview

LXL04_010050

Reference: OH-1004 Chr: Chr02 Coordinates: 138966449-138969439 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1539 bp · LXL04_010050|LXL04_010050|OH1004|cDNA

ATGGAAGATCTAAAGAAGGGATGTCAAATTCTCCCTTTCACCAGTTACACAAGTAGGACAGAATTCACcaaaattaaatataattttgcTTGGGGTGCAGCCACTGCTGCTTATCAGATTGAAGGTGCTGCATCTGAAGGTGGTAGAGGTCCATGTACTTGGGATACTTTCTGCGTTGAACATCCAGCTTCAATCATTAATGGTGATAATGGAAACACTGCTGTTAATTCTTATTTCAAAATGAAGGAAGATGTGCAAAT...

CDS

Download CDS FASTA

1539 bp · LXL04_010050|LXL04_010050|OH1004|CDS

ATGGAAGATCTAAAGAAGGGATGTCAAATTCTCCCTTTCACCAGTTACACAAGTAGGACAGAATTCACCAAAATTAAATATAATTTTGCTTGGGGTGCAGCCACTGCTGCTTATCAGATTGAAGGTGCTGCATCTGAAGGTGGTAGAGGTCCATGTACTTGGGATACTTTCTGCGTTGAACATCCAGCTTCAATCATTAATGGTGATAATGGAAACACTGCTGTTAATTCTTATTTCAAAATGAAGGAAGATGTGCAAAT...

Protein

Download Protein FASTA

512 aa · LXL04_010050|LXL04_010050|OH1004|PROTEIN

MEDLKKGCQILPFTSYTSRTEFTKIKYNFAWGAATAAYQIEGAASEGGRGPCTWDTFCVEHPASIINGDNGNTAVNSYFKMKEDVQMLKKTGLNAYRFSISWSRIFPGGRPNRGLNKEGVDYYNNLINELKANHIEPYVTLWHFDTPNCLQEEYGGFLDERIICDFKAYAEFCFWEFGDRVVNWITLNEPANNCVYGYDLGQFPPGRTEKGTTEPYIAAHNMLLAHATVVDLYRQRFQASQGGQIGITLDSMYYEPLNPR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010050`
TK1151 ID	TkA03G493150
OH-1004 ID	LXL04_010050
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010050

Location Chr02:138966449-138969439 (+)

Description Similar to BGLU10: Beta-glucosidase 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0474500`	Beta-glucosidase 10.	No verified direct reference in this release
`Os06g0320200`	Beta-glucosidase 24.	No verified direct reference in this release
`UniProt: Q7XKV5`	Beta-glucosidase 11.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010050 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009821 alkaloid biosynthetic process Biological Process

GO:0051259 protein complex oligomerization Biological Process

GO:0005634 nucleus Cellular Component

GO:0004565 beta-galactosidase activity Molecular Function

GO:0008422 beta-glucosidase activity Molecular Function

GO:0033907 beta-D-fucosidase activity Molecular Function

GO:0050247 raucaffricine beta-glucosidase activity Molecular Function

GO:0050506 vomilenine glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:AAF03675

ag:AAL93619

dosa:Os04g0474500

dosa:Os06g0320200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.588

Rank 1 · LXL04_010050 · OH-1004

Nucleus0.156

Rank 2 · LXL04_010050 · OH-1004

Peroxisome0.102

Rank 3 · LXL04_010050 · OH-1004

Mitochondrion0.089

Rank 4 · LXL04_010050 · OH-1004

Endoplasmic reticulum0.087

Rank 5 · LXL04_010050 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00232.25Glyco_hydro_126-487 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010050	`PF00232.25`	Glyco_hydro_1	26	487	1.8e-151	505.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7F9K4`	Oryza sativa subsp. japonica	Beta-glucosidase 10	48.708%	Swiss-Prot	moderate database homology
`Q5Z9Z0`	Oryza sativa subsp. japonica	Beta-glucosidase 24	48.485%	Swiss-Prot	moderate database homology
`Q7XKV5`	Oryza sativa subsp. japonica	Beta-glucosidase 11	48.269%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card