LXL04_009901 | RubberDandelionOmics

Gene overview

LXL04_009901

Reference: OH-1004 Chr: Chr02 Coordinates: 135668865-135670456 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1209 bp · LXL04_009901|LXL04_009901|OH1004|cDNA

ATGGCTTCCGCCTTTTCCATGGCCAATGCTTCCCTCCAGGTCAATGGCAAGGGATTCTCGGAGTTTGCCGGCCTTCGCAGCTCCTCTGCATCTCTTCCGTTCGGAAGGAAATCAGGTTCCGATGACTTCGTCTCAATGGTTGCCTTCCAGACAACTCTTGTGGGTGGAATCAAGACTCCTAAGGGAGTGACGGAAGCAAAACTGAAGGTGGCGATCAACGGGTTCGGTCGTATCGGAAGGAATTTCTTGAGGTGTTGGCA...

CDS

Download CDS FASTA

1209 bp · LXL04_009901|LXL04_009901|OH1004|CDS

ATGGCTTCCGCCTTTTCCATGGCCAATGCTTCCCTCCAGGTCAATGGCAAGGGATTCTCGGAGTTTGCCGGCCTTCGCAGCTCCTCTGCATCTCTTCCGTTCGGAAGGAAATCAGGTTCCGATGACTTCGTCTCAATGGTTGCCTTCCAGACAACTCTTGTGGGTGGAATCAAGACTCCTAAGGGAGTGACGGAAGCAAAACTGAAGGTGGCGATCAACGGGTTCGGTCGTATCGGAAGGAATTTCTTGAGGTGTTGGCA...

Protein

Download Protein FASTA

402 aa · LXL04_009901|LXL04_009901|OH1004|PROTEIN

MASAFSMANASLQVNGKGFSEFAGLRSSSASLPFGRKSGSDDFVSMVAFQTTLVGGIKTPKGVTEAKLKVAINGFGRIGRNFLRCWHGRKDSPLDVIAINDTGGVKQASHLLKYDSTLGIFDAEVKPVGDNGISVDGKIIKVVSDRNPSNLPWGEMGIDLVIEGTGVFVDRDGAGKHIEAGAKKVLITAPGKGDIPTYVVGVNADLYTHADTIISNASCTTNCLAPFVKVIDQKFGIIKGTMTTTHSYTGDQRLLDASHR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009901`
TK1151 ID	TkA03G481420
OH-1004 ID	LXL04_009901
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009901

Location Chr02:135668865-135670456 (+)

Description Similar to GAPA: Glyceraldehyde-3-phosphate dehydrogenase A, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12900`	Involved in the photosynthetic reductive pentose phosphate pathway (Calvin-Benson cycle).	No verified direct reference in this release
`At3g26650`	Involved in the photosynthetic reductive pentose phosphate pathway (Calvin-Benson cycle).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009901 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006006 glucose metabolic process Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009744 response to sucrose Biological Process

GO:0019253 reductive pentose-phosphate cycle Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009570 chloroplast stroma Cellular Component

KEGG gene cross-reference

ath:AT1G12900

ath:AT3G26650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.971

Rank 1 · LXL04_009901 · OH-1004

Mitochondrion0.058

Rank 2 · LXL04_009901 · OH-1004

Cytoplasm0.028

Rank 3 · LXL04_009901 · OH-1004

Peroxisome0.017

Rank 4 · LXL04_009901 · OH-1004

Nucleus0.016

Rank 5 · LXL04_009901 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00044.31Gp_dh_N69-170 aa

PF02800.27Gp_dh_C218-382 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009901	`PF00044.31`	Gp_dh_N	69	170	8.7e-32	110.1
LXL04_009901	`PF02800.27`	Gp_dh_C	218	382	1.2e-72	243.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPW0`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPA2, chloroplastic	87.438%	Swiss-Prot	strong database homology
`P25856`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPA1, chloroplastic	86.216%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card