LXL04_009857 | RubberDandelionOmics

Gene overview

LXL04_009857

Reference: OH-1004 Chr: Chr02 Coordinates: 135043936-135058892 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

8436 bp · LXL04_009857|LXL04_009857|OH1004|cDNA

atggctttccgacctccatacgctgctcgcaatcaacgaaggctagccgccctcatcgccaGGGAGGTTGCCAATGTCATCCCAACagttgccacccatctccactccattcagccgcaagctccagcaaccacccctcgttgcacgtttaaacatttccggagctgcagtccgccttacttcaaaggcaccgatggcgccaccGCACTACTAACCTGGTtcgaggagatggaaaataccttcattcacagcgagtgccc...

CDS

Download CDS FASTA

8436 bp · LXL04_009857|LXL04_009857|OH1004|CDS

ATGGCTTTCCGACCTCCATACGCTGCTCGCAATCAACGAAGGCTAGCCGCCCTCATCGCCAGGGAGGTTGCCAATGTCATCCCAACAGTTGCCACCCATCTCCACTCCATTCAGCCGCAAGCTCCAGCAACCACCCCTCGTTGCACGTTTAAACATTTCCGGAGCTGCAGTCCGCCTTACTTCAAAGGCACCGATGGCGCCACCGCACTACTAACCTGGTTCGAGGAGATGGAAAATACCTTCATTCACAGCGAGTGCCC...

Protein

Download Protein FASTA

2811 aa · LXL04_009857|LXL04_009857|OH1004|PROTEIN

MAFRPPYAARNQRRLAALIAREVANVIPTVATHLHSIQPQAPATTPRCTFKHFRSCSPPYFKGTDGATALLTWFEEMENTFIHSECPEDLKVRHATGCLQSHALTWWNSEKRARGDVVALAMTWAALKERMIEKFCPDSELQTLETEFWNLKQVGGDNATYTHRFQDLSRLLPHMVQPIKTAIRRYIKGLPRQIRDSVTSSKPTTLESAMDLAGQLNEDNVNDGVLSRKNSNATTETPQVVKSESSQKGDKKKRKTHHHN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009857`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009857

Location Chr02:135043936-135058892 (-)

Description Similar to Retrovirus-related Pol polyprotein from transposon TNT 1-94

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009857 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0075523 viral translational frameshifting Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

KEGG gene cross-reference

sce:YGR109W-B

spo:2542672

spo:2542797

spo:2543673

spo:3361218

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.630

Rank 1 · LXL04_009857 · OH-1004

Nucleus0.366

Rank 2 · LXL04_009857 · OH-1004

Mitochondrion0.100

Rank 3 · LXL04_009857 · OH-1004

Peroxisome0.057

Rank 4 · LXL04_009857 · OH-1004

Cell membrane0.038

Rank 5 · LXL04_009857 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03732.25PEG10_N-capsid58-135 aa

PF19259.5Ty3_capsid59-228 aa

PF08284.17RVP_2382-507 aa

PF30863.1PRO_PEG10-RTL1413-504 aa

PF00078.33RVT_1641-800 aa

PF17919.8RT_RNaseH_2864-957 aa

PF17917.8RT_RNaseH891-988 aa

PF17921.8Integrase_H2C21071-1127 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009857	`PF03732.25`	PEG10_N-capsid	58	135	3.2e-11	44.1
LXL04_009857	`PF19259.5`	Ty3_capsid	59	228	1.4e-11	44.9
LXL04_009857	`PF08284.17`	RVP_2	382	507	6.8e-29	101.1
LXL04_009857	`PF30863.1`	PRO_PEG10-RTL1	413	504	1.5e-08	35.8
LXL04_009857	`PF00078.33`	RVT_1	641	800	1e-42	147.0
LXL04_009857	`PF17919.8`	RT_RNaseH_2	864	957	5.2e-30	104.2
LXL04_009857	`PF17917.8`	RT_RNaseH	891	988	3.3e-33	114.7
LXL04_009857	`PF17921.8`	Integrase_H2C2	1071	1127	3.1e-18	66.4
LXL04_009857	`PF24626.2`	SH3_Tf2-1	1368	1432	1.9e-28	99.1
LXL04_009857	`PF13976.12`	gag_pre-integrs	1875	1917	2.8e-09	37.3
LXL04_009857	`PF00665.33`	rve	1932	2029	4.5e-18	66.1
LXL04_009857	`PF29688.1`	TnsB_C	1996	2049	1.2e-11	45.3
LXL04_009857	`PF25597.2`	SH3_retrovirus	2104	2162	2.9e-24	85.3
LXL04_009857	`PF07727.20`	RVT_2	2348	2589	2.2e-67	227.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT94`	Arabidopsis thaliana	Retrovirus-related Pol polyprotein from transposon RE2	47.273%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card