LXL04_009667 | RubberDandelionOmics

Gene overview

LXL04_009667

Reference: OH-1004 Chr: Chr02 Coordinates: 130930850-130934256 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3039 bp · LXL04_009667|LXL04_009667|OH1004|cDNA

ATGCCTGCAAATCGCAGCGGTAGTTACAGTGGTGGCCTTGTTGATCCCAGCAATCTCCATCTGAAAAAGGAGTTAACTCAGATTAGGAAAGCTGCTCGTACTTTACGAGATCGCGGTACGACTTCCTCCTGGCGGTCTCCGCTCAGCTCATCCAGATCCACCACTGCCGTCGCTATAGCAGCTTCCATCACCACTACCCCAAGCAACCATTATAATCACCACTACAGTTACAGTGTAGAAGAGAATAATGTTAACGAGAT...

CDS

Download CDS FASTA

3039 bp · LXL04_009667|LXL04_009667|OH1004|CDS

ATGCCTGCAAATCGCAGCGGTAGTTACAGTGGTGGCCTTGTTGATCCCAGCAATCTCCATCTGAAAAAGGAGTTAACTCAGATTAGGAAAGCTGCTCGTACTTTACGAGATCGCGGTACGACTTCCTCCTGGCGGTCTCCGCTCAGCTCATCCAGATCCACCACTGCCGTCGCTATAGCAGCTTCCATCACCACTACCCCAAGCAACCATTATAATCACCACTACAGTTACAGTGTAGAAGAGAATAATGTTAACGAGAT...

Protein

Download Protein FASTA

1012 aa · LXL04_009667|LXL04_009667|OH1004|PROTEIN

MPANRSGSYSGGLVDPSNLHLKKELTQIRKAARTLRDRGTTSSWRSPLSSSRSTTAVAIAASITTTPSNHYNHHYSYSVEENNVNEISNNVSGSSNNHNTSRRKEKKVFLYNWKTQRSESERSASVENTRRLNLNGDGDDSLSDARNDRDLNNVDNRYALSSSSKMFSNCKGATSLMKKKPHSSSSALKLGQQRHLILPDQYDEVNSDDMVIKSSKLLRGGSRKDDSSYCYSTTPALSTSSFSKYWIRNPSTVGSWDAGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009667`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009667

Location Chr02:130930850-130934256 (+)

Description Similar to At1g14460: Protein STICHEL-like 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14460`	Protein STICHEL-like 1.	No verified direct reference in this release
`At2g02480`	Acts as a key regulator of trichome branching through an endoreduplication-independent pathway.	No verified direct reference in this release
`At5g45720`	Protein STICHEL-like 4.	No verified direct reference in this release
`At4g24790`	Protein STICHEL-like 2.	No verified direct reference in this release
`At4g18820`	Protein STICHEL-like 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009667 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0010091 trichome branching Biological Process

GO:0005634 nucleus Cellular Component

GO:0005663 DNA replication factor C complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009360 DNA polymerase III complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G14460

ath:AT2G02480

ath:AT4G24790

ath:AT5G45720

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.444

Rank 1 · LXL04_009667 · OH-1004

Cytoplasm0.285

Rank 2 · LXL04_009667 · OH-1004

Cell membrane0.241

Rank 3 · LXL04_009667 · OH-1004

Plastid0.080

Rank 4 · LXL04_009667 · OH-1004

Endoplasmic reticulum0.062

Rank 5 · LXL04_009667 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13177.13DNA_pol3_delta2414-571 aa

PF00004.36AAA435-570 aa

PF22608.3DNAX_ATPase_lid577-618 aa

PF12169.14DNA_pol3_gamma3627-709 aa

PF23007.2DnaA_N-like_STI778-858 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009667	`PF13177.13`	DNA_pol3_delta2	414	571	6.9e-24	85.4
LXL04_009667	`PF00004.36`	AAA	435	570	1.6e-08	35.8
LXL04_009667	`PF22608.3`	DNAX_ATPase_lid	577	618	1.4e-08	35.1
LXL04_009667	`PF12169.14`	DNA_pol3_gamma3	627	709	6.5e-08	33.2
LXL04_009667	`PF23007.2`	DnaA_N-like_STI	778	858	3.8e-29	101.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HW65`	Arabidopsis thaliana	Protein STICHEL-like 1	46.387%	Swiss-Prot	moderate database homology
`O64728`	Arabidopsis thaliana	Protein STICHEL	61.121%	Swiss-Prot	moderate database homology
`F4KEM0`	Arabidopsis thaliana	Protein STICHEL-like 4	36.258%	Swiss-Prot	moderate database homology
`F4JRP8`	Arabidopsis thaliana	Protein STICHEL-like 2	41.785%	Swiss-Prot	weak database homology
`F4JRP0`	Arabidopsis thaliana	Protein STICHEL-like 3	39.627%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card