Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2055 bp · LXL04_009611|LXL04_009611|OH1004|cDNA
ATGAAATCCCCGCATCCCATCATCTTcctcatcatcttcttcatcatcgaTTCCAACGCAGCTAAACCAGCTTCCAGCATCGTCTTCACTACACTCGGCCGATCAAGGTATGCCTTCGACATATTCTCCCTCCCAATCACCACCACCGGCACTGAAATCCAACTTACCGACGGCAACTCCGTCAATTTCAACGGCTATTTCGCCTCCGGAAATCCCATATCCAATCCCACCACTGTTCACACACAACCCACACATCTCGT...
2055 bp · LXL04_009611|LXL04_009611|OH1004|CDS
ATGAAATCCCCGCATCCCATCATCTTCCTCATCATCTTCTTCATCATCGATTCCAACGCAGCTAAACCAGCTTCCAGCATCGTCTTCACTACACTCGGCCGATCAAGGTATGCCTTCGACATATTCTCCCTCCCAATCACCACCACCGGCACTGAAATCCAACTTACCGACGGCAACTCCGTCAATTTCAACGGCTATTTCGCCTCCGGAAATCCCATATCCAATCCCACCACTGTTCACACACAACCCACACATCTCGT...
Protein
Download Protein FASTA684 aa · LXL04_009611|LXL04_009611|OH1004|PROTEIN
MKSPHPIIFLIIFFIIDSNAAKPASSIVFTTLGRSRYAFDIFSLPITTTGTEIQLTDGNSVNFNGYFASGNPISNPTTVHTQPTHLVYVTERNGSSSIYLDSVYDAGMDRTRKRSVLEAELTRSQHRLVGGSSGRISMKDRPSLVGDYLVYVSTHEETGVGRTSWAAVYSTQLSTGLTRRLTPQGVADFSPAVSPSGLWTAVASSGEDGWGGEVEELNTDIYVFLTRDGSSRVKVVEHGGWPSWVDDSTFFFHRKSDDGW...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_009611 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_009611 |
|---|---|
| Location | Chr02:129708515-129710569 (+) |
| Description | Similar to tolB: Tol-Pal system protein TolB (Geobacter metallireducens (strain GS-15 / ATCC 53774 / DSM 7210) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0017038 protein import Biological Process GO:0051301 cell division Biological Process |
| KEGG gene cross-reference | cte:CT0636 gme:Gmet_3540 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF07676.20PD40344-498 aaPF07676.20PD40432-570 aaPF26549.1Tricorn_N457-569 aaPF00930.28DPPIV_N480-591 aaPF26550.2Tricorn_2nd486-643 aaPF26549.1Tricorn_N576-639 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_009611 | PF07676.20 | PD40 | 344 | 498 | 6.8e-36 | 124.5 |
| LXL04_009611 | PF07676.20 | PD40 | 432 | 570 | 6.8e-36 | 124.5 |
| LXL04_009611 | PF26549.1 | Tricorn_N | 457 | 569 | 1.8e-31 | 110.1 |
| LXL04_009611 | PF00930.28 | DPPIV_N | 480 | 591 | 9.5e-11 | 41.7 |
| LXL04_009611 | PF26550.2 | Tricorn_2nd | 486 | 643 | 8.6e-10 | 38.6 |
| LXL04_009611 | PF26549.1 | Tricorn_N | 576 | 639 | 1.8e-31 | 110.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.